View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11486_low_12 (Length: 237)
Name: NF11486_low_12
Description: NF11486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11486_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 506017 - 505807
Alignment:
| Q |
1 |
catatataaattatttgacttttcttttttagggaataaattatttgacttcaattcagatttgaatttagattcctctattttgcttcatttaatacat |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
506017 |
catatataatttatttgacttttcttttttagggaataaattatttgacttaaattcagttttgaatttagattcctctattttgcttcattta------ |
505924 |
T |
 |
| Q |
101 |
ttactattttgattttaaatccattatcttagttcgtagttttttaaatggtcgactttttccacacattttaagattgagttttgatgaggtgacaagg |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
505923 |
---ctattttgattttaaatccactatcttagttcgtagttttttaaatggtcgactttttccatacattttaagattgagttttgatgaggtgacaaat |
505827 |
T |
 |
| Q |
201 |
gagctgtttaagtagcaact |
220 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
505826 |
aagctgtttaagtagtaact |
505807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University