View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11486_low_13 (Length: 231)
Name: NF11486_low_13
Description: NF11486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11486_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 2097783 - 2097999
Alignment:
| Q |
1 |
tgtgaacttgagtgttaccaatgcaaccaaaagtgcaaacattttgtaaatgatgtctcctaagtctttaatcacctctcccttgaagttgcatttcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2097783 |
tgtgaacttgagtgttaccaatgcaaccaaaagtgcaaacattttgtaaatgatgtctcctaagcctttaatcacctctcccttgaagttgcatttcctc |
2097882 |
T |
 |
| Q |
101 |
atttccgcctctcctcctatttattcaggtgtttgcatttcctcaatgatgataggatggtaaaactgttgtatcttttcaatcatgatttcgtactttt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2097883 |
atttccgcctctcctcctattttttcaggtgtttgcatttcctcaatgatgataggatggtaaaactgttgtatcttttcattcatgatttcgtactttt |
2097982 |
T |
 |
| Q |
201 |
atactagtacttctgtg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2097983 |
atactagtacttctgtg |
2097999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University