View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11487_low_5 (Length: 283)
Name: NF11487_low_5
Description: NF11487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11487_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 274
Target Start/End: Complemental strand, 28329177 - 28328920
Alignment:
| Q |
17 |
aaagagattgttggataaggaatagctaagtggtttcaacaagatgcctctgaagaatgagagaaaagggaaaaaagagaatgtatctcttcttatttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28329177 |
aaagagattgttggataaggaatagctaagtggtttcaacaagatgcctctgaagaatgagagaaaagggaaaaaagagaatgtatctcttcttatttca |
28329078 |
T |
 |
| Q |
117 |
ctaacttttaccaaactaccataacaaacttctattatatgcttctaactaactgttgagctgtcctctaactgtttgcttagctggctttgttgtgaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28329077 |
ctaacttttaccaaactaccataacaaacttctattatatgcttctaactaactgttgagctgtcctctaactgtttgcttagctggctttgttgtgaat |
28328978 |
T |
 |
| Q |
217 |
taataacttgcattccaagttatatgtgctatgtttagtttctaatatctctgcttct |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28328977 |
taataacttgcattccaagttatatgtgctatgtttagtttctaatatctcttcttct |
28328920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 84
Target Start/End: Complemental strand, 28329231 - 28329174
Alignment:
| Q |
27 |
ttggataaggaatagctaagtggtttcaacaagatgcctctgaagaatgagagaaaag |
84 |
Q |
| |
|
||||| |||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28329231 |
ttggacaaggaaaggctaagtggtttcagtgagatgcctctgaagaatgagagaaaag |
28329174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University