View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11488_high_7 (Length: 239)
Name: NF11488_high_7
Description: NF11488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11488_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 77 - 223
Target Start/End: Original strand, 42237262 - 42237408
Alignment:
| Q |
77 |
tatgtttgttgtttagaattaagtggttaattaagattgctaataacttattgtgtggcctattataggtttattggacccatggtcacctatgagaagc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42237262 |
tatgtttgttgtttagaattaagtggttaattaagattactaataacttattgtgtggcctattataggtttattggacccatggtcgcctatgagaagc |
42237361 |
T |
|
| Q |
177 |
atgcgtcaaatgttagacacaatggaccgaatcttcgaagatacaat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237362 |
atgcgtcaaatgttagacacaatggaccgaatcttcgaagatacaat |
42237408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 42237156 - 42237224
Alignment:
| Q |
1 |
atggttcaataacataacaatcatggaattttctttttacgtttttaaaatgctaagaataagtaaagg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42237156 |
atggttcaataacataacaatcatggaattttctttttacgtttttaaaatgctaagaataagtaaagg |
42237224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University