View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11488_low_4 (Length: 370)
Name: NF11488_low_4
Description: NF11488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11488_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 144 - 363
Target Start/End: Original strand, 21174913 - 21175132
Alignment:
| Q |
144 |
gttatctccttcctataaaacactttcacagcactcacaaaatgaatagcgtaaacactagcagcaccagaactcgcaaatatcgtaattagcacgtgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21174913 |
gttatctccttcctataaaacactttcacagtactcacaaaatgaatagcgtaaacactagcagcaccagaactcgcaaatatcgtaattagcacgtgct |
21175012 |
T |
 |
| Q |
244 |
ctttcacgttaaatttccctggattcaacgtaaactcccatttctttcctttcatgaaaactctcttcgttatagttgatgccattagatgccccaatgg |
343 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21175013 |
ctttcacgttaaacttccctggattcaacgtaaactcccatttcttccctttcatgaaaactctcttcgttatagttgatgccattagatgccccaatgg |
21175112 |
T |
 |
| Q |
344 |
aaccaccgctatctgtgctg |
363 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21175113 |
aaccaccgctatctgtgctg |
21175132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 21174787 - 21174845
Alignment:
| Q |
18 |
gaaacttggacaagattttgtggccaccacataccagctggctccacaagatacctccg |
76 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21174787 |
gaaacttggacaagattttggggccaccacataccagctggctccacaagatacctccg |
21174845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University