View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11488_low_6 (Length: 250)
Name: NF11488_low_6
Description: NF11488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11488_low_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 5 - 250
Target Start/End: Original strand, 42236814 - 42237054
Alignment:
| Q |
5 |
agacaattctgtggaagttcaacatgttaacaaaggtgatcaaggtcatggttccgctgtagagagaaagcctcgtagaggttccatggacatgatttca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236814 |
agacaattctgtggaagttcaacatgttaacaaaggtgatcaaggtcatggttccgctgtagagagaaagcctcgtagaggttccatggacatgatttca |
42236913 |
T |
|
| Q |
105 |
ccatttggtgagttttcatctcttttttcatcaacaccaagaatactagcaacacattttctcataccaaatttaaaatttatgattcctattagatcat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
42236914 |
ccatttggtgagttttcatctcttttttcatcaacaccaagaatactagcaacacattttctcataccaaatttaaaatttatgattcttgttagatcag |
42237013 |
T |
|
| Q |
205 |
gtgcgcgcgtctcatgtcatatatgtttgatgaaaaataaatcttt |
250 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42237014 |
gtgcgcgcgtc-----tcatatatgtttgatgaaaaataaatcttt |
42237054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University