View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_high_16 (Length: 497)
Name: NF1148_high_16
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 47 - 453
Target Start/End: Original strand, 46008743 - 46009149
Alignment:
| Q |
47 |
aaacattcaccaacaactactccaagagaccaaaatacacatcaagtactaaaacaatcatcaccaccacctgcagtcaacattgaagcacaagtttcaa |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46008743 |
aaacattcaccaacaactactccaagagaccaaaatacacatcaagtactaaaacaatcatcaccaccacctgcagtcaacattgaagcacaagtttcaa |
46008842 |
T |
|
| Q |
147 |
gagtttcaacaaagccacaaacacaagcaatgtcagagaaggaggacaaaaaatctttcccaaaatgcaagaaaacagcacatgggaatttgagtccacg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46008843 |
gagtttcaacaaagccacaaacacaagcaatgtcagagaaggaggacaaaaaatctttcccaaaatgcaagaaaacagcacatgggaatttgagtccacg |
46008942 |
T |
|
| Q |
247 |
gataaacagaaacaagcctcctcagaaatcatcatcaatcagaaacaagcaagaagaatcattcataaccactagagctagtgatatcaaaaccaatagc |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46008943 |
gataaacagaaacaagcctcctcagaaatcatcatcaatcagaaacaagcaagaagaatcattcataaccactagagctagtgatatcaaaaccaatagc |
46009042 |
T |
|
| Q |
347 |
aagagaactcatccaatttctaacaacaatgtcccaaatcttctccatctcaaaacacacccttctcttccagctcaaaaacaggtaccaattatttcaa |
446 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009043 |
aagagaactcatccaatttctaacaacaatgtcccaaatcttctccatctcaaaacacacctttctcttccagctcaaaaacaggtaccaattatttcaa |
46009142 |
T |
|
| Q |
447 |
tcttcac |
453 |
Q |
| |
|
||||||| |
|
|
| T |
46009143 |
tcttcac |
46009149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University