View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1148_high_53 (Length: 294)

Name: NF1148_high_53
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1148_high_53
NF1148_high_53
[»] chr2 (1 HSPs)
chr2 (138-286)||(33717547-33717693)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 138 - 286
Target Start/End: Complemental strand, 33717693 - 33717547
Alignment:
138 ataacttcgccatcaactcctcaaattcatatttcaacccacaaatagtaatggatccacacacaatgtaaacaaattataaaatgtaactaacatagac 237  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |  |||||||||||||||||||||||||||||||||||    
33717693 ataacttccccatcaactcctcaaattcatatttcaacccacaaatagtaatggatccacaaa--atgtaaacaaattataaaatgtaactaacatagac 33717596  T
238 tatttcaaagaatttacacatgttttgcacagaatcacaattagttcat 286  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
33717595 tatttcaaagaatttacacatgttttgcacagaatcacaattagttcat 33717547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University