View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_high_55 (Length: 282)
Name: NF1148_high_55
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 25889971 - 25889825
Alignment:
| Q |
1 |
ttttagctccctcagtttccatggcatcgtagtgctccttgggattatctttcgtattaacattgaagggttttgtctggttgacatcaagttgcttgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25889971 |
ttttagctccctcagtttccatggcatcgtagtgctccttgggattatctttcgtattaacattgaagggttttgtctggttggcatcaagttgcttgga |
25889872 |
T |
|
| Q |
101 |
gatttgtccgatttgaacttctaaacctttgatcgaagcttttgtat |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25889871 |
gatttgtccgatttgaacttctaaacctttgatcgaagcttttgtat |
25889825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 213 - 269
Target Start/End: Complemental strand, 25889830 - 25889774
Alignment:
| Q |
213 |
ttgtatagtagggtgattatagagactagtatcatttttcttgtataccagccttct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25889830 |
ttgtatagtagggtgattatagagactagtatcatttttcttgtataccagccttct |
25889774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University