View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1148_high_70 (Length: 223)

Name: NF1148_high_70
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1148_high_70
NF1148_high_70
[»] chr4 (2 HSPs)
chr4 (75-202)||(12850481-12850608)
chr4 (89-192)||(42048972-42049075)
[»] chr5 (1 HSPs)
chr5 (75-186)||(3575011-3575122)


Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 75 - 202
Target Start/End: Original strand, 12850481 - 12850608
Alignment:
75 ccacagatgaggagcttgttgattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgatctttacaaaattga 174  Q
    |||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
12850481 ccacagatgaagaacttgtggattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgacctttacaaaattga 12850580  T
175 accatgggatcttgaagggataggatat 202  Q
    |||||||||||||||||| ||| |||||    
12850581 accatgggatcttgaaggtataagatat 12850608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 89 - 192
Target Start/End: Complemental strand, 42049075 - 42048972
Alignment:
89 cttgttgattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgatctttacaaaattgaaccatgggatcttg 188  Q
    ||||||||||||||||| ||||||||  |  | || | || ||||||||| |||||||| ||||| |||||||| || |||||||||||||||||||||     
42049075 cttgttgattactacctcaggaagaaggtatcgtctaaaaagattgatctcgatgtcatcaaagacgttgatctctataaaattgaaccatgggatcttc 42048976  T
189 aagg 192  Q
    ||||    
42048975 aagg 42048972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 75 - 186
Target Start/End: Original strand, 3575011 - 3575122
Alignment:
75 ccacagatgaggagcttgttgattactaccttaggaagaaaattgcttcaagaaggattgatcttgatgtcataaaagatgttgatctttacaaaattga 174  Q
    |||| ||||| || ||||||||| ||||||||||||| || || ||||| | |||||||||||||||| |||| |||||||||||||| || || |||||    
3575011 ccactgatgaagaacttgttgatcactaccttaggaaaaagatagcttctaaaaggattgatcttgatatcattaaagatgttgatctctataagattga 3575110  T
175 accatgggatct 186  Q
     || ||||||||    
3575111 gccgtgggatct 3575122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University