View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_high_72 (Length: 211)
Name: NF1148_high_72
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_high_72 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 9503301 - 9503444
Alignment:
| Q |
18 |
tcattacaagtatcacatgtctagtcaataatcacacgaggatactcatcaaattagttaatagttatgtaaatgtccattacagt-ggaggatatgtgg |
116 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
9503301 |
tcatcacaagtattacatgtctagtcaataatcatacgaggatactcatcaaattagttaatagttatgtaaatgtccattatagtgggaggatatgtgg |
9503400 |
T |
 |
| Q |
117 |
gggcatgactcatgagtacagtttagttagttttaacttctgaa |
160 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9503401 |
gggcatgactcatgagtacaatttagttagttttagtttctgaa |
9503444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University