View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_40 (Length: 359)
Name: NF1148_low_40
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 16 - 330
Target Start/End: Original strand, 32291300 - 32291615
Alignment:
| Q |
16 |
atgaatatatgtgacgctcggattgggggatttgttggttctgaagtcatacttagattagaactatggg-tgacagcattgattgttgtgtagtggtgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32291300 |
atgaatatatgtgacgctcggattgggggatttgttggttctgaagtcatacttagattagaactatggggtgacagcattgattgttgtgtagtggtgg |
32291399 |
T |
 |
| Q |
115 |
tgtatgtcggttactttattccaaaacagcaaataaaagcaaaacttgtg-cagatgaatatacacaaacttgtttccacgcacacaacacatgcacgct |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32291400 |
tgtatgtcggttactttattccaaaacagcaaataaaagcaaaacttgtggcagatgaatatacacaaacttgtttccacgcacacaacacatgcacgct |
32291499 |
T |
 |
| Q |
214 |
ttaatttcatttcttcgatgtatggaaatggtgctactactgttatgcttgcttgcttactgtgttgcctgttcattgcaattcacaacacgttttttgg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32291500 |
ttaatttcatttcttcgatgtatggaaatggtgctactactgttatgcttgcttgcttactgtgttgcctgttcattgcaattcacaacacg-tttttgg |
32291598 |
T |
 |
| Q |
314 |
ttgtttgattttgatgt |
330 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
32291599 |
ttttttgattttgatgt |
32291615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University