View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_44 (Length: 353)
Name: NF1148_low_44
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_44 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 80 - 253
Target Start/End: Original strand, 13212344 - 13212517
Alignment:
| Q |
80 |
gctgttgctggttctgctgctgttgttgttgacttcccatggttcccggtgaccctaaccctccatttcctggcacattcactggtgtttcttcatcttc |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212344 |
gctgttgctggttctgctgctgttgttgttgacttcccatggttcccggtgaccctaaccctccatttcctggcacattcactggtgtttcttcatcttc |
13212443 |
T |
 |
| Q |
180 |
taaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13212444 |
taaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacg |
13212517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University