View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_45 (Length: 350)
Name: NF1148_low_45
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 138 - 257
Target Start/End: Complemental strand, 33717693 - 33717576
Alignment:
| Q |
138 |
ataacttcgccatcaactcctcaaattcatatttcaacccacaaatagtaatggatccacacacaatgtaaacaaattataaaatgtaactaacatagac |
237 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33717693 |
ataacttccccatcaactcctcaaattcatatttcaacccacaaatagtaatggatccacaaa--atgtaaacaaattataaaatgtaactaacatagac |
33717596 |
T |
 |
| Q |
238 |
tatttcaaagaatttacaca |
257 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33717595 |
tatttcaaagaatttacaca |
33717576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University