View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_46 (Length: 349)
Name: NF1148_low_46
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 15 - 320
Target Start/End: Original strand, 45381416 - 45381724
Alignment:
| Q |
15 |
ggcttacaagggaattggaatgtgagcaatgcaaagaaggaaaatatgatcaactcaaggaaggttttggaggtgaattttaattcctctcatcaaaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45381416 |
ggcttacaagggaattggaatgtgagcaatgcaaagaaggaaaatatgatcaactcaaggaaggttttggaggtgaattttaattcctctcatcaaaaca |
45381515 |
T |
|
| Q |
115 |
atgacacattgaacaaccacaacaaacgaagattttcattggtgattacaaattctaatcatggtagtacttttcataaagtggacacaattaatggaac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45381516 |
atgacacattgaacaaccacaacaaacgaagattttcattggtgattacaaattctaatcatggtagtacttttcataaagtggacacaattaatggaac |
45381615 |
T |
|
| Q |
215 |
taaggtgaatggtttacaagtggtagaggctcctaaaaaattgctaaat---gaaaatacaacagatgttgctcttgttaccaatgggagatttgttgaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45381616 |
taaggtgaatggtttacaagtggtagaggctcctaaaaaattgctaaatgaagaaaatacaacagatgttgctcttgttaccaatgggagatttgttgaa |
45381715 |
T |
|
| Q |
312 |
ggaaggttt |
320 |
Q |
| |
|
||||||||| |
|
|
| T |
45381716 |
ggaaggttt |
45381724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University