View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_49 (Length: 342)
Name: NF1148_low_49
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_49 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0168 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 29 - 330
Target Start/End: Original strand, 20288 - 20589
Alignment:
| Q |
29 |
acaaacaacagtcccagatggtcttacaggtttaacaagaaatcaccattagaaaagacagaatttgcctctgactcgcacgaggtaatgaattctgttc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20288 |
acaaacaacagtcccagatggtcttacaggtttaacaagaaatcaccattagaaaagacagaatttgcctctgactcgcacgaggtaatgaattctgttc |
20387 |
T |
 |
| Q |
129 |
aaaatgatttcgatgatgccattgtaaacaatttgaagagacaagttcgtttggaccggaaatcactcatggctttgtacatggatttggacgaagaaag |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20388 |
aaaatgatttcgatgatgccattgtaaacaatttgaagagacaagttcgtttggaccggaaatcactcatggctttgtacatggatttggacgaagaaag |
20487 |
T |
 |
| Q |
229 |
aagtgcttcagctgtcgctgcaaacaacgcaatggcaatgatcacacggttacaggctgagaaagcagcagtgcagatggaagctttgcagtatcaaaga |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20488 |
aagtgcttcagctgtcgctgcaaacaacgcaatggcaatgatcacacggttacaggctgagaaagcagcagtgcagatggaagctttgcagtatcaaaga |
20587 |
T |
 |
| Q |
329 |
at |
330 |
Q |
| |
|
|| |
|
|
| T |
20588 |
at |
20589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 153 - 273
Target Start/End: Original strand, 44351157 - 44351277
Alignment:
| Q |
153 |
taaacaatttgaagagacaagttcgtttggaccggaaatcactcatggctttgtacatggatttggacgaagaaagaagtgcttcagctgtcgctgcaaa |
252 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| || || || |||||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| || |
|
|
| T |
44351157 |
taaataatttgaagaggcaagttcgtttggatcgcaagtcgctcatggctttgtacatggagttggatgaagagagaagtgcttcagctgttgctgccaa |
44351256 |
T |
 |
| Q |
253 |
caacgcaatggcaatgatcac |
273 |
Q |
| |
|
||| || |||||||||||||| |
|
|
| T |
44351257 |
caatgctatggcaatgatcac |
44351277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University