View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_53 (Length: 327)
Name: NF1148_low_53
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_53 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 3 - 241
Target Start/End: Complemental strand, 47364659 - 47364421
Alignment:
| Q |
3 |
ttgcaaagaccaaaaacatgcacgttatgagaactttactcttaacagtaattttaatagtgcacacagttcaaagaattaaaataatgatgcatgtgat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364659 |
ttgcaaagaccaaaaacatgcacgttatgagaactttactcttaacagtaattttaatagtgcacacagttcaaagaattaaaataatgatgcatgtgat |
47364560 |
T |
|
| Q |
103 |
gtagattgagtgagatccaacatccaaaattgattacctatcctatccatcatatgaaatttccattaactctttaaaaaaggagaagattcatagttat |
202 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47364559 |
gtagattgagtgagaaccaacatccaaaattgattacctatcctatccatcatatgaaatttccataaactctttaaaaaaggagaagattcatagttat |
47364460 |
T |
|
| Q |
203 |
gagacctaggtgctttgaaaaaagcatagtgatgatgtc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47364459 |
gagacctaggtgctttgaaaaaagcatagtgatgatgtc |
47364421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University