View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_55 (Length: 324)
Name: NF1148_low_55
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 93 - 296
Target Start/End: Original strand, 25457656 - 25457859
Alignment:
| Q |
93 |
atgttctaatcactaaaacatttgcaatccaaaacccagtggttttcgacatacgaaacgacttgtcgagcaacaacttaggagatctagcagttggttg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||| |||||||||||||||||||| |
|
|
| T |
25457656 |
atgttctaatcactaaaacatttgcaatccaaaacccagtggttttcgacatccgaaacgacttgccgagcaacatcttgggagatctagcagttggttg |
25457755 |
T |
|
| Q |
193 |
caaccaatccgatcatatgtctcatatcaatgtgggagatcactacaatcgaacattccaagttggtcaaagttgggagtgtgatgcttcatggtctagg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25457756 |
caaccaatccgatcatatgtctcatatcaatgtgggagatcactacaatcgaacattccaagttggtcaaagttgggagtgtgatgcttcatggtctagg |
25457855 |
T |
|
| Q |
293 |
tatt |
296 |
Q |
| |
|
|||| |
|
|
| T |
25457856 |
tatt |
25457859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 25457583 - 25457640
Alignment:
| Q |
8 |
acccctagctaacatcacaaaacaatggcttatcaaaactacttcaccttctttatac |
65 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25457583 |
acccccagctaacatcacaaaacaatggcttatcaaaactacttcaccttctttatac |
25457640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University