View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_60 (Length: 318)
Name: NF1148_low_60
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_60 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 99 - 302
Target Start/End: Original strand, 7232395 - 7232599
Alignment:
| Q |
99 |
tcttcttcaatgggatatgcggtgcaaaatagacatgtatttattaaaaaaacatatggattataaagtggattacgttattgttcnnnnnnnnnnnnn- |
197 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7232395 |
tcttcttcaatggaatatgcggtgcaaaatagacatatatttattaaaaaa-catatggattataaagtggattacgttcttgttcaaaaaaataaataa |
7232493 |
T |
|
| Q |
198 |
-gtggattacgttaattcatgaatagcctacggtaatacaccatatgttttcatagttagatcaaatatagttactagatcttagcatgattcttcatta |
296 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7232494 |
agtggattacgttaattcatgaataacctacggtaatacaccatatgttttcatagttagatcaaatatagttactagatcttagcatgattcttcatta |
7232593 |
T |
|
| Q |
297 |
aattga |
302 |
Q |
| |
|
|||||| |
|
|
| T |
7232594 |
aattga |
7232599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University