View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1148_low_72 (Length: 282)

Name: NF1148_low_72
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1148_low_72
NF1148_low_72
[»] chr8 (2 HSPs)
chr8 (1-147)||(25889825-25889971)
chr8 (213-269)||(25889774-25889830)


Alignment Details
Target: chr8 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 25889971 - 25889825
Alignment:
1 ttttagctccctcagtttccatggcatcgtagtgctccttgggattatctttcgtattaacattgaagggttttgtctggttgacatcaagttgcttgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
25889971 ttttagctccctcagtttccatggcatcgtagtgctccttgggattatctttcgtattaacattgaagggttttgtctggttggcatcaagttgcttgga 25889872  T
101 gatttgtccgatttgaacttctaaacctttgatcgaagcttttgtat 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
25889871 gatttgtccgatttgaacttctaaacctttgatcgaagcttttgtat 25889825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 213 - 269
Target Start/End: Complemental strand, 25889830 - 25889774
Alignment:
213 ttgtatagtagggtgattatagagactagtatcatttttcttgtataccagccttct 269  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25889830 ttgtatagtagggtgattatagagactagtatcatttttcttgtataccagccttct 25889774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University