View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_73 (Length: 277)
Name: NF1148_low_73
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_73 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 39 - 240
Target Start/End: Original strand, 28256457 - 28256658
Alignment:
| Q |
39 |
taaggcaccaaccaatagaaaataccgtgaagaaaataacaactagaaaagatttgtgggctctaagagagtaagtgctcatatttttaggaactacaaa |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28256457 |
taaggcaccaaccaatagaaaataccgtgaagaaaataacaactaggaaagatttgtgggctctaagagagtaagtgctcatatttgtaggaactacaaa |
28256556 |
T |
|
| Q |
139 |
ctcaagtgtagcataaaatcaattttcattagtagagaaaaaatgtaagctagctagcaaatgtagggggtactatactataccatacaaagaggggcct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28256557 |
ctcaagtgtagcataaaatcaattttcattagtagagaaaaaatgtaagctagctagcaaatgtagggggtactatactataccatacaaagaggggcct |
28256656 |
T |
|
| Q |
239 |
at |
240 |
Q |
| |
|
|| |
|
|
| T |
28256657 |
at |
28256658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University