View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1148_low_78 (Length: 255)

Name: NF1148_low_78
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1148_low_78
NF1148_low_78
[»] chr8 (1 HSPs)
chr8 (1-96)||(41188216-41188310)


Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 41188310 - 41188216
Alignment:
1 ctttctctgtttcttcttcttcttcaccatctaactgaatttcactttcaatcctcaatctcaaggtatgcacaagcaatcctccatcgccgtaaa 96  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||    
41188310 ctttctctgtttcttcttcttcttcaccatctaacttaatttcactttcaatcctcaatcccaaggtatgcacaagc-atcctccatcgccgtaaa 41188216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University