View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_82 (Length: 251)
Name: NF1148_low_82
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_82 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 40 - 251
Target Start/End: Original strand, 3665542 - 3665752
Alignment:
| Q |
40 |
taatattttactctacatattttcaaaatagatcgttggactgaatatttaattatattaccagatcatctataaaaaaccattttacataatctaaaac |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3665542 |
taatattttactctacatattttcaaaatagatcgttggactgaatatttaattatattaccagatcatctataaaaaaacattttacataatctaaaac |
3665641 |
T |
 |
| Q |
140 |
ttgaataatgagtcattttatatattattgtgatgtgatgcgtcaagactaatacacatttagatgattacatcgatgtagtttgatctcttctctttta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |||| |
|
|
| T |
3665642 |
ttgaataatgagtcattttatatattattgtgatgtgatgcgtcaagactaatacacatttggatgattacatcgatgtagtttgatctcttatc-ttta |
3665740 |
T |
 |
| Q |
240 |
agtcgtaccaat |
251 |
Q |
| |
|
| |||||||||| |
|
|
| T |
3665741 |
actcgtaccaat |
3665752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University