View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_86 (Length: 243)
Name: NF1148_low_86
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_86 |
 |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0105 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |  |
|
| [»] scaffold0578 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 200)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 11 - 104
Target Start/End: Original strand, 2800610 - 2800703
Alignment:
| Q |
11 |
tcaaaagatggtgaaaactacatttcaagagttctttataaaaatgtatttaatttgaaagagnnnnnnnnngagaaacaagtattttattttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2800610 |
tcaaaagatggtgaaaactacatttcaagagttcttgataaaaatgtatttaatttgaaagagtttttttttgagaaacaagtattttattttt |
2800703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 44641441 - 44641377
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44641441 |
tttatttatggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
44641377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 17984706 - 17984651
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17984706 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
17984651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 100 - 162
Target Start/End: Complemental strand, 7001902 - 7001840
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7001902 |
tttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7001840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 15335292 - 15335240
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
15335240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 52254488 - 52254424
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
52254488 |
tttatttttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
52254424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35307715 - 35307770
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35307715 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 50429209 - 50429154
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50429209 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
50429154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 96 - 162
Target Start/End: Complemental strand, 45290829 - 45290763
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
45290829 |
tttattttaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
45290763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 48955714 - 48955764
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48955714 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
48955764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 990379 - 990322
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
990379 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
990322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 18473272 - 18473329
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18473272 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18473329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 26061956 - 26062013
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26061956 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26062013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 32729049 - 32728992
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32729049 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
32728992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 35308113 - 35308056
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35308113 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35308056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 38136983 - 38136926
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38136983 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 41358369 - 41358426
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41358369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41358426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 41358663 - 41358606
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41358663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt |
41358606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 45380638 - 45380581
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45380638 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 3679987 - 3679931
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
3679987 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
3679931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 21391087 - 21391151
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21391087 |
tttattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
21391151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 24653797 - 24653857
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24653797 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 29072867 - 29072807
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
29072867 |
tttttggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg |
29072807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 92 - 160
Target Start/End: Complemental strand, 30323305 - 30323238
Alignment:
| Q |
92 |
gtattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30323305 |
gtattttattta-ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 38151217 - 38151157
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38151217 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38151157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 1810927 - 1810982
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1810927 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 13770489 - 13770544
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13770489 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13770544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 18302387 - 18302332
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18302387 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 22919684 - 22919739
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22919684 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22919739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 24649348 - 24649399
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24649348 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 26324585 - 26324640
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26324585 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
26324640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 29072497 - 29072552
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29072497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29072552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 32626529 - 32626584
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32626529 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 35005749 - 35005694
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35005749 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35005694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 35056894 - 35056839
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35056894 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 45368490 - 45368545
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45368490 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45368545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 3753214 - 3753268
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3753268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 11822004 - 11822054
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11822004 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
11822054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 18473595 - 18473545
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18473595 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18473545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 26324947 - 26324897
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26324947 |
ggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagt |
26324897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 33379888 - 33379938
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33379888 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
33379938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 990088 - 990145
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
990088 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggt |
990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 19623017 - 19622960
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19623017 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
19622960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 22953558 - 22953501
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
22953558 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctg |
22953501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 31258339 - 31258396
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
31258339 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
31258396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 44641079 - 44641128
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44641128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 45290457 - 45290514
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45290457 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
45290514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 45368847 - 45368794
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctg |
45368794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 100 - 161
Target Start/End: Complemental strand, 46868582 - 46868521
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
46868582 |
tttttggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgg |
46868521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 48956068 - 48956011
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
48956068 |
ttggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
48956011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 16060894 - 16060830
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
16060894 |
tttaattttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16060830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 18899842 - 18899894
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 24977769 - 24977833
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
24977769 |
tttattattggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 26191357 - 26191409
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26191357 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
26191409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 33000296 - 33000360
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
33000296 |
tttattttcggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
33000360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 33234913 - 33234857
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
33234913 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg |
33234857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 37545627 - 37545683
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
37545627 |
tggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 44157690 - 44157750
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44157690 |
tttttcgctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3679626 - 3679681
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
3679626 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
3679681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3753572 - 3753517
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
3753572 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
3753517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 6567496 - 6567441
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6567496 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
6567441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 12361011 - 12361066
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
12361011 |
ggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctg |
12361066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13260321 - 13260266
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13260321 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 14007489 - 14007544
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14007489 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14007544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 19622650 - 19622705
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19622650 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19622705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21383104 - 21383159
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
21383104 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
21383159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24507843 - 24507788
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24507843 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 26191735 - 26191684
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26191735 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26191684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 26442899 - 26442844
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
26442899 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
26442844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 32454294 - 32454239
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
32454294 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctg |
32454239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 33045690 - 33045635
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33045690 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35005444 - 35005499
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
35005444 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 38164295 - 38164240
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38164295 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 47819232 - 47819287
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47819232 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 47819596 - 47819541
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47819596 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 50799130 - 50799185
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
50799130 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50799185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 156
Target Start/End: Original strand, 7818783 - 7818833
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtt |
7818833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 17984333 - 17984383
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17984333 |
ggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagt |
17984383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 26442563 - 26442613
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26442613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 29688428 - 29688378
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29688428 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
29688378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 108 - 162
Target Start/End: Complemental strand, 31258699 - 31258645
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggt |
31258645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 48609594 - 48609544
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48609594 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48609544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 52254183 - 52254233
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52254183 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
52254233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 4323829 - 4323878
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
4323878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 10631162 - 10631219
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10631162 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10631219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 15516576 - 15516637
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
15516576 |
attttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 24507477 - 24507534
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24507477 |
ttggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 96 - 153
Target Start/End: Original strand, 25658005 - 25658062
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||||||||||| |||| ||||| ||||||||| ||||||||||||||| |
|
|
| T |
25658005 |
tttatttttggctaaaatatggttttggtccccgcaaatatgtctcgttttggtttta |
25658062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 40718108 - 40718165
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40718108 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 41881093 - 41881150
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
41881093 |
ggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggt |
41881150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 45638578 - 45638635
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
45638578 |
ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 18900130 - 18900078
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
18900078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 35056529 - 35056585
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35056529 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 38163934 - 38163986
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3247198 - 3247253
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3247198 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3247253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 8140434 - 8140489
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8140434 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8140489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 8140799 - 8140744
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
8140799 |
ggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 10631528 - 10631473
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10631528 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 11822365 - 11822310
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
11822365 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 12360968 - 12360913
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12360968 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 13259988 - 13260043
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13259988 |
ggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctg |
13260043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 15058413 - 15058468
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
15058413 |
ttttttgctaaaatatggttttggtccctgcaaatatgactcgttttggttttagt |
15058468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 15526362 - 15526307
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
15526362 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 16026938 - 16026883
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
16026938 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19720712 - 19720767
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19720712 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19720767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 109 - 160
Target Start/End: Complemental strand, 24649656 - 24649605
Alignment:
| Q |
109 |
aaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
24649605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30322929 - 30322984
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30322929 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 33000669 - 33000614
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33000669 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 33234546 - 33234601
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
33234546 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
33234601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 34002940 - 34002885
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
34002940 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 37624746 - 37624793
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
37624746 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggtttt |
37624793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 39747835 - 39747780
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
39747835 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 45380272 - 45380327
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45380272 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 48609236 - 48609291
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
48609236 |
ggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg |
48609291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 110 - 160
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
2939984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 7819103 - 7819053
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
7819103 |
ggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagt |
7819053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 10887598 - 10887548
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
10887598 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
10887548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 103 - 153
Target Start/End: Complemental strand, 12322972 - 12322922
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
12322972 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
12322922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 16026573 - 16026623
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
16026573 |
ggctaaaatataattttggtccctgcaaatatccctcgttttggttttagt |
16026623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 147
Target Start/End: Complemental strand, 18079660 - 18079618
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttg |
147 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18079660 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 22919977 - 22919927
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
22919977 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagt |
22919927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 108 - 162
Target Start/End: Complemental strand, 26062255 - 26062201
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggt |
26062201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 27521577 - 27521631
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
27521631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 31060784 - 31060842
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
31060784 |
tttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg |
39303729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 44158042 - 44157992
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
44158042 |
ggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagt |
44157992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 159
Target Start/End: Complemental strand, 45638894 - 45638840
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
45638894 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcct |
45638840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 46868226 - 46868276
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
46868226 |
ggctaaattatgattttagtccctgcaaatatgcttcattttggttttagt |
46868276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 24654167 - 24654118
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
24654167 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
24654118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 41738794 - 41738851
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||| |||||||| |||| |
|
|
| T |
41738794 |
ttggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg |
41738851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 1159840 - 1159784
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||| |||||||||||||| |||| |
|
|
| T |
1159840 |
tggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctg |
1159784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 7867124 - 7867184
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| ||||||||| |||||||||| |||||||| |||||||| |||| |
|
|
| T |
7867124 |
ttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 10887228 - 10887288
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
10887228 |
ttttaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 34808200 - 34808252
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg |
34808252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 38150851 - 38150903
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 46183686 - 46183734
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
46183734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 7350426 - 7350473
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagt |
7350473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 15211859 - 15211812
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
15211859 |
tggctaaaatatggttttggtccttgcaaatatgcctcgttttggttt |
15211812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 20948751 - 20948810
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||| ||||||| ||||||||| |||| |
|
|
| T |
20948751 |
ttttggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg |
20948810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 21391371 - 21391324
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagt |
21391324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24978122 - 24978067
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24978122 |
ggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 33045355 - 33045410
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| || |||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
33045355 |
ggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg |
33045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 33067348 - 33067395
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
33067348 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggtttt |
33067395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 34002635 - 34002682
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
34002635 |
ggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 39025382 - 39025332
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
39025382 |
tggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagt |
39025332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 49923818 - 49923763
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||| |||||||| ||||||| |||| |
|
|
| T |
49923818 |
ggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg |
49923763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 15211511 - 15211561
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
15211511 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagt |
15211561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 16060596 - 16060645
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
16060596 |
ggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagt |
16060645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 16083047 - 16083097
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
16083047 |
ggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagt |
16083097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 107 - 153
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 33067729 - 33067675
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||||| |||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctg |
33067675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 42482979 - 42483029
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
42482979 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
42483029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 292872 - 292909
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
292872 |
ttttagtccctgcaaatatgcctcgttttgcttttagt |
292909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 4324163 - 4324118
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggtttta |
4324118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 4360626 - 4360577
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
4360626 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttag |
4360577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 12360603 - 12360652
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||| ||||||| |
|
|
| T |
12360603 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttag |
12360652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 16083394 - 16083349
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagt |
16083349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 17129691 - 17129744
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg |
17129744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 155
Target Start/End: Original strand, 26142413 - 26142470
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| ||||||||||| ||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
26142413 |
tattttaggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagt |
26142470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 26207280 - 26207333
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 34382948 - 34382996
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctcg-tttggttttagt |
34382996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 40718476 - 40718419
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| | |||||| ||||||| |||| |
|
|
| T |
40718476 |
ttggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 41739120 - 41739068
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
41739120 |
ggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctg |
41739068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 137
Target Start/End: Complemental strand, 1811235 - 1811203
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1811235 |
ggctaaaatatgattttagtccctgcaaatatg |
1811203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 5058989 - 5058937
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg |
5058937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 157
Target Start/End: Complemental strand, 15058766 - 15058714
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
15058766 |
ggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttc |
15058714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 33380258 - 33380206
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccc-tgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
33380258 |
tggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagt |
33380206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 34383245 - 34383189
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| | |||||||||||||| |||| |
|
|
| T |
34383245 |
tggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctg |
34383189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 157
Target Start/End: Complemental strand, 42483271 - 42483219
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| | ||||||||||| |||| |
|
|
| T |
42483271 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggttttggttc |
42483219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 48730615 - 48730567
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagt |
48730567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 49073691 - 49073739
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
49073691 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
49073739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 50428873 - 50428921
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
50428873 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttgctttta |
50428921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 7350733 - 7350686
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagt |
7350686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 7867357 - 7867302
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
7867357 |
ggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 12361369 - 12361319
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
12361369 |
ggctaaaatatgattttagtccctgca-----gcctcgttttggttttagtccctg |
12361319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 18079398 - 18079453
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| | |||| |||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
18079398 |
ggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg |
18079453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 20756022 - 20756069
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||| ||| || ||||||| ||||||||||||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagt |
20756069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 24510309 - 24510258
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
24510309 |
tggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 31061151 - 31061096
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31061151 |
ggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 32906237 - 32906190
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgattttagt |
32906190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 137
Target Start/End: Complemental strand, 2604196 - 2604154
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatg |
137 |
Q |
| |
|
|||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
2604196 |
tttttttttaggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 152
Target Start/End: Complemental strand, 7350663 - 7350629
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
7350663 |
ttttggtccctgcaaatatgcctcgttttggtttt |
7350629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 155
Target Start/End: Original strand, 12322600 - 12322654
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
12322600 |
ttttggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagt |
12322654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 160
Target Start/End: Original strand, 18302070 - 18302108
Alignment:
| Q |
122 |
agtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccctg |
18302108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 22674203 - 22674253
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
22674203 |
ggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagt |
22674253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 152
Target Start/End: Original strand, 28507188 - 28507222
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28507188 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28507222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 146
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgtttt |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 147
Target Start/End: Original strand, 36912853 - 36912895
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttg |
147 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
36912853 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 25658299 - 25658246
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctg |
25658246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 147
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttg |
147 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 37625026 - 37624977
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||||| |||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagt |
37624977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 47038866 - 47038923
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || |||| |||||| || |||||| |
|
|
| T |
47038866 |
ggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggt |
47038923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 15334917 - 15334965
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||| || ||| ||||||| ||||||||||||||| |
|
|
| T |
15334917 |
ggctaaaatatggttttaatctctgtaaatatgactcgttttggtttta |
15334965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 39025112 - 39025156
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
39025156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 152
Target Start/End: Complemental strand, 49074062 - 49074006
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||| |||||||||||| |||| |||| || |||||||| |||||||| |||| |
|
|
| T |
49074062 |
tttattttaggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 3e-26; HSPs: 178)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 41694012 - 41693948
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41694012 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
41693948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 23989833 - 23989888
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989833 |
ttttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
23989888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 16900206 - 16900149
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16900206 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16900149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 16993597 - 16993540
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16993597 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
16993540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 19184151 - 19184094
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19184151 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19184094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 26814229 - 26814172
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26814229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
26814172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 34317796 - 34317853
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34317796 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
34317853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 37271739 - 37271796
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37271739 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37271796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 37272102 - 37272045
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37272102 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37272045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 38980253 - 38980196
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38980253 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
38980196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 7814742 - 7814682
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
7814742 |
ttttaggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
7814682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 9195053 - 9195109
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9195053 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 12835324 - 12835380
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
12835324 |
tggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
12835380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 5334747 - 5334806
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5334747 |
ttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24483891 - 24483836
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24483891 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24483836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 26813864 - 26813923
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26813864 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
26813923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 33732862 - 33732917
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33732862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33732917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 5790557 - 5790615
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5790557 |
tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
5790615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 22881613 - 22881663
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22881613 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22881663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 103 - 153
Target Start/End: Complemental strand, 33733243 - 33733193
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33733243 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 43788858 - 43788908
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43788858 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
43788908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 3671194 - 3671137
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3671194 |
ttggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 5790901 - 5790844
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5790901 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 11713483 - 11713540
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
11713483 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 17541382 - 17541439
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
17541382 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
17541439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 98 - 155
Target Start/End: Original strand, 17912442 - 17912499
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17912442 |
tattttaggttaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
17912499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 19183782 - 19183839
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
19183782 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
19183839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 24358610 - 24358671
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24358610 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 40124964 - 40125021
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40124964 |
ttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 43597148 - 43597209
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
43597148 |
attttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
43597209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 44073807 - 44073750
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
44073807 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
44073750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 44985623 - 44985676
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44985676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 1497605 - 1497665
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
1497605 |
tttttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
1497665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 2481566 - 2481502
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2481566 |
tttatttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 5335041 - 5334985
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5335041 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 8046649 - 8046593
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
8046649 |
tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
8046593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 20131682 - 20131626
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20131682 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 95 - 155
Target Start/End: Complemental strand, 27311079 - 27311019
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| | |||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27311079 |
ttttattgtaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagt |
27311019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 95 - 151
Target Start/End: Complemental strand, 41791322 - 41791266
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
41791322 |
ttttttttttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttt |
41791266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 42358702 - 42358754
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 2265397 - 2265342
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
2265397 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg |
2265342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 4423895 - 4423950
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4423895 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 8046329 - 8046384
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8046329 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
8046384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 9195206 - 9195151
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9195206 |
ggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg |
9195151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 11713845 - 11713790
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11713845 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
11713790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 11788416 - 11788361
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
11788416 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 14003742 - 14003687
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14003742 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 15842823 - 15842768
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15842823 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 16522991 - 16523046
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16522991 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 16523325 - 16523270
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16523325 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25705449 - 25705394
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25705449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 29859872 - 29859817
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29859872 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 31225715 - 31225770
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31225715 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 36622250 - 36622305
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36622305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 38731829 - 38731884
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38731829 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38731884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 40302339 - 40302284
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40302339 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
40302284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 43592046 - 43592101
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
43592046 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
43592101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 43597499 - 43597444
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
43597499 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
43597444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 43710708 - 43710653
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
43710708 |
ggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg |
43710653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 3172020 - 3172070
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
3172020 |
ggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagt |
3172070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 3172532 - 3172482
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
3172532 |
ggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagt |
3172482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 3838263 - 3838209
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
3838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 10671941 - 10671891
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10671941 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
10671891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 151
Target Start/End: Original strand, 27310876 - 27310922
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27310876 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
27310922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 29859484 - 29859542
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29859484 |
tttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 38639412 - 38639462
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38639412 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
38639462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 45442696 - 45442646
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
45442696 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagt |
45442646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 7814246 - 7814303
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
7814246 |
ggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
7814303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 10375070 - 10375021
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10375070 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10375021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 31325910 - 31325975
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||||||||| || |||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
31325910 |
ttttttttttggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg |
31325975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 36622582 - 36622533
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtt |
36622533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 94 - 162
Target Start/End: Original strand, 38979878 - 38979947
Alignment:
| Q |
94 |
attttatttttggctaaaatatgattttagtccctgcaaatat-gcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38979878 |
attttatttctggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggt |
38979947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 43789192 - 43789135
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
43789192 |
ggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggt |
43789135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 14003404 - 14003464
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
14003404 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 20131312 - 20131372
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20131312 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 23732037 - 23732089
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
23732037 |
ttggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
23732089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 27109071 - 27109123
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
27109071 |
ttggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagt |
27109123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 31226077 - 31226029
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggtttta |
31226029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 42695866 - 42695918
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
42695866 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
42695918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 43671925 - 43671989
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||||||| |||| ||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
43671925 |
tttatttaaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3671003 - 3671058
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
3671003 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg |
3671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 4424185 - 4424130
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4424185 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 10665294 - 10665239
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10665294 |
ggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg |
10665239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 13215060 - 13215115
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13215060 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 16673771 - 16673716
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
16673771 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 96 - 155
Target Start/End: Complemental strand, 17541785 - 17541726
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
17541785 |
tttatttaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
17541726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 17912808 - 17912761
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
17912761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 18113089 - 18113144
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
18113089 |
ggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 20658061 - 20658116
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
20658061 |
ggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20658116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24358945 - 24358890
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24358945 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25705085 - 25705140
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25705085 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25705140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 26239160 - 26239105
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
26239160 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 29865511 - 29865456
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
29865511 |
ggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctg |
29865456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30215422 - 30215477
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
30215422 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 33576117 - 33576062
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33576117 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 36815835 - 36815780
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
36815835 |
ggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 40125289 - 40125234
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||| |||| |
|
|
| T |
40125289 |
ggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg |
40125234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 40301975 - 40302030
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |||||||| |||| |
|
|
| T |
40301975 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctg |
40302030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 41451837 - 41451892
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
41451837 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 41693674 - 41693729
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
41693674 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
41693729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 44559062 - 44559117
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44559062 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 44985984 - 44985929
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44985984 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
44985929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 4042610 - 4042660
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4042610 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
4042660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 24483401 - 24483455
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctg |
24483455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 25954115 - 25954165
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25954115 |
ggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagt |
25954165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 26709696 - 26709746
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
26709696 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagt |
26709746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 31644841 - 31644891
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
31644841 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
31644891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 101 - 155
Target Start/End: Original strand, 43710377 - 43710431
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
43710377 |
ttttggttaaaatataattttagtcccttcaaatatgtctcgttttggttttagt |
43710431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 152
Target Start/End: Original strand, 1137983 - 1138028
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
1138028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 29182440 - 29182391
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtt |
29182391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 38231425 - 38231486
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||| |||||| ||||||| |||| |
|
|
| T |
38231425 |
atttttggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctg |
38231486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 41791020 - 41791073
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
41791073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 42696202 - 42696153
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
42696153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 146691 - 146635
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
146691 |
tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
146635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 4042892 - 4042840
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
4042892 |
ttggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagt |
4042840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 16968555 - 16968607
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg |
16968607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 25954423 - 25954371
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
25954371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 26238816 - 26238868
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26238868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 32691313 - 32691361
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32691313 |
ggctaaaatatggttttagtttctgcaaatatgcctcgttttggtttta |
32691361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 33575747 - 33575807
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33575747 |
ttttaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 34318085 - 34318033
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||| |||||| |||||||||||||||||| ||||||| |
|
|
| T |
34318085 |
ttggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagt |
34318033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 111 - 155
Target Start/End: Original strand, 35155298 - 35155342
Alignment:
| Q |
111 |
aatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagt |
35155342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 36806897 - 36806841
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
36806897 |
tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
36806841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 37911120 - 37911072
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
37911120 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
37911072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 40786455 - 40786515
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| ||||| || ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40786455 |
ttttaggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg |
40786515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 44559407 - 44559359
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
44559359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3837933 - 3837988
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
3837933 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 10664984 - 10665039
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| | ||||| |||| |
|
|
| T |
10664984 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctg |
10665039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 10671630 - 10671685
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10671630 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 16673411 - 16673466
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
16673411 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 153
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 153
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 17302143 - 17302088
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
17302143 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 23990193 - 23990146
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
23990146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 26707873 - 26707928
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
26707873 |
ggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctg |
26707928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 31326252 - 31326197
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
31326252 |
ggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctg |
31326197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 32476095 - 32476150
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
32476095 |
ggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg |
32476150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 34964161 - 34964110
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
34964161 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttag |
34964110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 43672318 - 43672263
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
43672318 |
ggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg |
43672263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 14393128 - 14393079
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
14393128 |
ggctaaaatatgattt-agttcctgcaaatatgtctcgttttggttttagt |
14393079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 103 - 153
Target Start/End: Complemental strand, 18113456 - 18113406
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
18113456 |
ttggctaaaatatggttttggtccctacaaatatgcttcgttttggtttta |
18113406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 151
Target Start/End: Complemental strand, 23732328 - 23732282
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
23732328 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttt |
23732282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 31909478 - 31909429
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
31909478 |
ggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagt |
31909429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 37228733 - 37228783
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
37228733 |
ggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagt |
37228783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 43592380 - 43592330
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||| ||||| ||||||| |
|
|
| T |
43592380 |
ggctaaaatatgattttagtccctgctaatatgtctcattttgattttagt |
43592330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 44994061 - 44994011
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
44994061 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagt |
44994011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg |
25299800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 38732130 - 38732085
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||| ||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
38732130 |
taaaatttgattttagtcccagcaaatatggctcgttttggtttta |
38732085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 160
Target Start/End: Complemental strand, 1138372 - 1138304
Alignment:
| Q |
92 |
gtattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| | ||| |||||||||||| |||| |||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
1138372 |
gtatttgaatttaggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg |
1138304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 19831511 - 19831563
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
19831563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 45442316 - 45442364
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||| ||||| |
|
|
| T |
45442316 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 151
Target Start/End: Complemental strand, 1696452 - 1696409
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
1696452 |
taaaatatgattttcgtcccttcaaatatgtctcgttttggttt |
1696409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 2481193 - 2481248
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| || | |||||||||| ||||||||||||||||| |||| |
|
|
| T |
2481193 |
ggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 3832634 - 3832587
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagt |
3832587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 13215365 - 13215318
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
13215365 |
ggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 13850881 - 13850834
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| || ||||||||||||| |||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagt |
13850834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 20658409 - 20658362
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||| |||| |
|
|
| T |
20658409 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgatttt |
20658362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 30215871 - 30215816
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
30215871 |
ggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg |
30215816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 155
Target Start/End: Original strand, 4842860 - 4842914
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||| |||| | |||||||||||| ||||||||||||||||| |
|
|
| T |
4842860 |
ttttcgctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagt |
4842914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 29182168 - 29182218
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| || ||||||||||||| |
|
|
| T |
29182168 |
ggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagt |
29182218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 152
Target Start/End: Original strand, 29831885 - 29831919
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
29831885 |
ttttggtccctgcaaatatgcctcgttttggtttt |
29831919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 4794468 - 4794423
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| |||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagt |
4794423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 160
Target Start/End: Complemental strand, 22881950 - 22881913
Alignment:
| Q |
123 |
gtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctg |
22881913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 105 - 146
Target Start/End: Complemental strand, 32691635 - 32691594
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgtttt |
146 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
32691635 |
ggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 136
Target Start/End: Original strand, 2411261 - 2411293
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
2411261 |
tggctaaaatatgcttttagtccctgcaaatat |
2411293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 5006610 - 5006658
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||| |||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagtt |
5006658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 11788047 - 11788107
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| || || ||||||| ||| |||||||| |||||||| |||| |
|
|
| T |
11788047 |
tttttggctaaaatatgatgttgatctctgcaaaaatgtctcgttttcgttttagtccctg |
11788107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 13802486 - 13802534
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||||| | || |||||| |||||||||||||||| |
|
|
| T |
13802486 |
ggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 25300038 - 25299987
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagttcct |
25299987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 35686335 - 35686287
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggttttagtt |
35686287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 37229039 - 37228991
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagtt |
37228991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 212)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 98 - 162
Target Start/End: Complemental strand, 35415640 - 35415576
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35415640 |
tatttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35415576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 93 - 160
Target Start/End: Original strand, 32365082 - 32365149
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32365082 |
tattttaatttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
32365149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 11 - 73
Target Start/End: Original strand, 4249922 - 4249984
Alignment:
| Q |
11 |
tcaaaagatggtgaaaactacatttcaagagttctttataaaaatgtatttaatttgaaagag |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
4249922 |
tcaaaagatggtgaaaactacatttcaagagttcttgataaaaatgtatttaatttggaagag |
4249984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 93 - 162
Target Start/End: Complemental strand, 6827887 - 6827817
Alignment:
| Q |
93 |
tattttattttt-ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6827887 |
tattttattttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6827817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 50714232 - 50714297
Alignment:
| Q |
97 |
ttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
50714232 |
ttatttttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
50714297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 45505894 - 45505839
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45505894 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
45505839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
11285558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 55482471 - 55482413
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
55482471 |
tttggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctg |
55482413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
9446004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 23778964 - 23779021
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23778964 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttggt |
23779021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 35763647 - 35763704
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35763647 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
35763704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 35763955 - 35763898
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35763955 |
ggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctggt |
35763898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 41345853 - 41345910
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41345853 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41345910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 99 - 155
Target Start/End: Original strand, 22099537 - 22099593
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22099537 |
atttatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22099593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 23245226 - 23245286
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23245226 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 35464387 - 35464327
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35464387 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 53717175 - 53717119
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53717175 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
53717119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 4279336 - 4279285
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4279336 |
tggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagt |
4279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 12791974 - 12791919
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12791974 |
ggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg |
12791919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13064465 - 13064410
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13064465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 16712691 - 16712636
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16712691 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16712636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 52017505 - 52017560
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52017505 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 52017870 - 52017815
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52017870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 15555506 - 15555560
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15555560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 18205156 - 18205206
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18205156 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18205206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 20291986 - 20292036
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20291986 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
20292036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 98 - 160
Target Start/End: Complemental strand, 26412591 - 26412529
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26412591 |
tatttttggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 32208542 - 32208592
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32208542 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32208592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 41619902 - 41619956
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
41619956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 50714566 - 50714508
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
50714566 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
50714508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 123534 - 123591
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
123534 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
123591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 9289266 - 9289323
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9289266 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 42823770 - 42823831
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42823770 |
attttaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 46115412 - 46115469
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46115412 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 46128546 - 46128603
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46128546 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 95 - 152
Target Start/End: Original strand, 46292382 - 46292439
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
46292382 |
ttttatttatggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
46292439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 13064154 - 13064214
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
13064154 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
13064214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 27008083 - 27008139
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27008083 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27008139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 38054549 - 38054601
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38054601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 42848392 - 42848336
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42848392 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 45593591 - 45593531
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
45593591 |
ttttaggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 161
Target Start/End: Complemental strand, 46088060 - 46088004
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
46088060 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgg |
46088004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 51545966 - 51545914
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51545914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 2034855 - 2034800
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
2034855 |
ggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 2180220 - 2180275
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
2180220 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
2180275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13479611 - 13479556
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13479611 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13479556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13530713 - 13530658
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13530713 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 24774045 - 24774100
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24774045 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 29463913 - 29463866
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29463913 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 29499182 - 29499237
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29499182 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 30046792 - 30046737
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30046792 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 30061133 - 30061078
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30061133 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 32365483 - 32365428
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
32365483 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
32365428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 43231389 - 43231334
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43231389 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 45505600 - 45505655
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
45505600 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
45505655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 53916047 - 53915992
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53916047 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 55072389 - 55072444
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
55072389 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
55072444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 110 - 160
Target Start/End: Original strand, 2034544 - 2034594
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
2034594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 5052584 - 5052534
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052584 |
ggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5052534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 6827546 - 6827596
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6827546 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6827596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 8191394 - 8191336
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
8191394 |
tttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
8191336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 22099912 - 22099862
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22099912 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
22099862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 24474963 - 24474913
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24474963 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
24474913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 25358543 - 25358485
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
25358543 |
tttggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 94 - 160
Target Start/End: Original strand, 28809000 - 28809066
Alignment:
| Q |
94 |
attttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
28809000 |
attttttttttggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg |
28809066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 28809180 - 28809130
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28809180 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
28809130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 29380910 - 29380860
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29380910 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29380860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 103 - 161
Target Start/End: Original strand, 29463608 - 29463666
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29463608 |
ttggctaaaatatggttttatttcctgcaaatatgcctcgttttggttttaattcctgg |
29463666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 34361803 - 34361853
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34361803 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34361853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 94 - 160
Target Start/End: Original strand, 35464007 - 35464073
Alignment:
| Q |
94 |
attttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35464007 |
atttttttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35464073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 46292651 - 46292601
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46292651 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
46292601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 51545629 - 51545679
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51545629 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
51545679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 51708693 - 51708743
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51708693 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
51708743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 51709027 - 51708977
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51709027 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
51708977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 9289639 - 9289582
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9289639 |
ggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
9289582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 13073757 - 13073814
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13073757 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 35415299 - 35415356
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
35415299 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
35415356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 41620256 - 41620199
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
41620256 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggt |
41620199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 2322088 - 2322148
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||| |||| |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
2322088 |
tttttagctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg |
2322148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 161
Target Start/End: Original strand, 4211561 - 4211617
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
4211561 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
4211617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 152
Target Start/End: Complemental strand, 9446328 - 9446276
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
9446328 |
ttttcggctaaaatatgattttagtccctgtaaatatgtctcgttttggtttt |
9446276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 13074131 - 13074075
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
13074131 |
attttaggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagt |
13074075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 91 - 155
Target Start/End: Complemental strand, 19903669 - 19903605
Alignment:
| Q |
91 |
agtattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| | |||||| |||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
19903669 |
agtattatttttttgactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
19903605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 29499543 - 29499491
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 41324895 - 41324835
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
41324895 |
tttttggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg |
41324835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 47274236 - 47274180
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
47274236 |
atttttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 97 - 160
Target Start/End: Original strand, 4279014 - 4279077
Alignment:
| Q |
97 |
ttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||||||| |||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4279014 |
ttattttaggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg |
4279077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 5827973 - 5827918
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5827973 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 5882552 - 5882606
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
5882552 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctg |
5882606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 8760781 - 8760726
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
8760781 |
ggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg |
8760726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 153
Target Start/End: Original strand, 13479273 - 13479320
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
13479320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 13631228 - 13631283
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13631228 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13631283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13631599 - 13631544
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13631599 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 14487802 - 14487849
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
14487802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
14487849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 14791806 - 14791751
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14791806 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 18136113 - 18136058
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
18136113 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
18136058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19321570 - 19321625
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
19321570 |
ggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25423924 - 25423979
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25423924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25424312 - 25424257
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25424312 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 93 - 160
Target Start/End: Original strand, 30060757 - 30060824
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| | || ||||||||| |||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30060757 |
tattttattataggttaaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 36702000 - 36702055
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
36702000 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
36702055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 43231088 - 43231143
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
43231088 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 46115779 - 46115724
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
46115779 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 46128913 - 46128858
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
46128913 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 49123321 - 49123266
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
49123321 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
49123266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 52430100 - 52430045
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
52430100 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
52430045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 52441763 - 52441818
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
52441763 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
52441818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 52442092 - 52442037
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
52442092 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
52442037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 53915683 - 53915738
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
53915683 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 54903475 - 54903420
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
54903475 |
ggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 101 - 155
Target Start/End: Complemental strand, 2180576 - 2180522
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
2180576 |
ttttggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagt |
2180522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 6353637 - 6353583
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
6353583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 22584287 - 22584337
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
22584287 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
22584337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 110 - 160
Target Start/End: Complemental strand, 27008401 - 27008351
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
27008351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 28448834 - 28448884
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
28448834 |
ggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagt |
28448884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 29420537 - 29420487
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
29420537 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29420487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 32208901 - 32208851
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
32208901 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagt |
32208851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 36702362 - 36702308
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg |
36702308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 41346218 - 41346168
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
41346218 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagt |
41346168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 45474596 - 45474546
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
45474596 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt |
45474546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 53716921 - 53716971
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
53716921 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
53716971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 123893 - 123848
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagt |
123848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 5797479 - 5797536
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5797479 |
ttggttaaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 5827653 - 5827710
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
5827653 |
ttggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 15555637 - 15555588
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
15555588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 19321861 - 19321804
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
19321861 |
ttggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
19321804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 43368467 - 43368520
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
43368520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 94 - 155
Target Start/End: Complemental strand, 47136182 - 47136121
Alignment:
| Q |
94 |
attttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||| ||||| ||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
47136182 |
attttttttttcgctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
47136121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 8904886 - 8904934
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8904886 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 16712331 - 16712379
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagt |
16712379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 161
Target Start/End: Original strand, 29380668 - 29380724
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||| || ||||| |
|
|
| T |
29380668 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctgg |
29380724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 31560696 - 31560640
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
31560696 |
tggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
31560640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 42824097 - 42824041
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| || |||||| ||||||| |
|
|
| T |
42824097 |
atttttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt |
42824041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 53308069 - 53308013
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
53308069 |
tggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg |
53308013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 2322432 - 2322377
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
2322432 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 8760604 - 8760659
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8760604 |
ggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg |
8760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 11693121 - 11693066
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
11693121 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 12152493 - 12152446
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
12152493 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttt |
12152446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 13764613 - 13764668
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||| ||| |||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 14488187 - 14488132
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
14488187 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 160
Target Start/End: Complemental strand, 14594561 - 14594510
Alignment:
| Q |
109 |
aaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctg |
14594510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 14791502 - 14791549
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
14791549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 22584607 - 22584552
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| || |||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
22584607 |
ggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg |
22584552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 23245595 - 23245540
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
23245595 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
23245540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 23779225 - 23779170
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
23779225 |
ggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 26412190 - 26412245
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26412190 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 27427872 - 27427926
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27427872 |
ggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 31370804 - 31370855
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
31370804 |
ggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagtt |
31370855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 31560331 - 31560386
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
31560331 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 31812213 - 31812158
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31812213 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 34355283 - 34355228
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
34355283 |
ggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg |
34355228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35119292 - 35119347
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
35119292 |
ggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg |
35119347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 160
Target Start/End: Complemental strand, 35420715 - 35420648
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| |||||| |||||||||| |||| |||| |||||||||| |||| |||||||||||| |||| |
|
|
| T |
35420715 |
tattttttttttgactaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 36054150 - 36054095
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| | |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
36054150 |
ggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg |
36054095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 41920766 - 41920825
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||| ||| ||||| |||||||| ||||| |
|
|
| T |
41920766 |
ttggttaaaatatggttttagtccctgcaaatatgactcattttgattttagtttctggt |
41920825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 42848027 - 42848082
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42848027 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
42848082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 45593228 - 45593283
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||| |||||| |||| |
|
|
| T |
45593228 |
ggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctg |
45593283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 54208822 - 54208775
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
54208775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 20144423 - 20144469
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
20144469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 24474600 - 24474649
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
24474600 |
ggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagt |
24474649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg |
37557140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 41921084 - 41921034
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
41921084 |
ggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagt |
41921034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 44925485 - 44925535
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
44925485 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
44925535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||| | ||||||||||||||||||||||||||| |||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg |
44925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 110 - 160
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 107 - 153
Target Start/End: Complemental strand, 52543725 - 52543679
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggtttta |
52543679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 5202924 - 5202977
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcg-ttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
5202924 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgtttttggttttagt |
5202977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| || |||||||||||||| |||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg |
18831123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 106 - 151
Target Start/End: Original strand, 25358213 - 25358258
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggttt |
25358258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 30564835 - 30564888
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 153
Target Start/End: Complemental strand, 8905238 - 8905186
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||||| |||| ||||||| ||||||||||| ||||| ||||| |
|
|
| T |
8905238 |
ttttggctaaaatatggttttggtccctgtaaatatgcctcattttgatttta |
8905186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 20144731 - 20144683
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| || | |||||||||||||||||||||||||| |
|
|
| T |
20144731 |
ggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 26313983 - 26314043
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
26313983 |
tttttggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg |
26314043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 43368778 - 43368722
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| ||||| | || ||||||||| ||||||||||||||||||||| |
|
|
| T |
43368778 |
tggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctg |
43368722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 50753925 - 50753977
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 51738137 - 51738185
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
51738137 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggtttta |
51738185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 52543422 - 52543470
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
52543422 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 155
Target Start/End: Complemental strand, 3653733 - 3653690
Alignment:
| Q |
112 |
atatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
3653733 |
atatgattttagtccctgtaaatataccttgttttggttttagt |
3653690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 7642652 - 7642597
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctg |
7642597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 12152154 - 12152209
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
12152154 |
ggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg |
12152209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 13530379 - 13530434
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
13530379 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 14594201 - 14594256
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
14594201 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt |
14594256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 26314332 - 26314277
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
26314332 |
ggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 31182504 - 31182449
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||| ||||||||||||| ||| |||| |
|
|
| T |
31182504 |
ggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg |
31182449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 31811925 - 31811980
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
31811925 |
ggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg |
31811980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 161
Target Start/End: Original strand, 36050359 - 36050402
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctgg |
36050402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 37556841 - 37556896
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||| || ||||||||| ||||| |||||||||||| |||| |
|
|
| T |
37556841 |
ggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg |
37556896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 47022743 - 47022790
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagt |
47022790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 47023105 - 47023050
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
47023105 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 51738411 - 51738364
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||||| |||| |
|
|
| T |
51738411 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttgatttt |
51738364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 121 - 160
Target Start/End: Original strand, 54208477 - 54208516
Alignment:
| Q |
121 |
tagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctg |
54208516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 8191076 - 8191130
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || ||||| |||||||| |||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctg |
8191130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 11692762 - 11692812
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| || |||| ||||||||||||||||| ||||||| ||||||| |
|
|
| T |
11692762 |
ggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagt |
11692812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 13764807 - 13764757
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
13764807 |
ggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagt |
13764757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 151
Target Start/End: Complemental strand, 35119611 - 35119565
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
35119611 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttggttt |
35119565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 5797817 - 5797772
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggtttta |
5797772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| ||||| |||||||||| | |||||||||||||| |||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg |
35420446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 51830891 - 51830944
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||| ||||| || |||||||||||||| |||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctg |
51830944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 5063013 - 5063064
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| |||||||||| ||| |||| |
|
|
| T |
5063013 |
taaaatatg-ttttagtccctgcaaatataccttgttttggtttaagtccctg |
5063064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 22204052 - 22204112
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| | |||| ||||||||| |||||| |
|
|
| T |
22204052 |
tttggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggt |
22204112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 136
Target Start/End: Complemental strand, 22205282 - 22205250
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
22205282 |
tggctaaaatatgcttttagtccctgcaaatat |
22205250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 150
Target Start/End: Complemental strand, 25358496 - 25358464
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtt |
150 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
25358496 |
ttttagtccctgcaaatatgtctcgttttggtt |
25358464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 28449214 - 28449166
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||||||||| ||||| |
|
|
| T |
28449214 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 136
Target Start/End: Original strand, 35054665 - 35054693
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35054665 |
taaaatatgattttagtccctgcaaatat |
35054693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 136
Target Start/End: Complemental strand, 42359410 - 42359374
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
42359410 |
tttttggctaaaatatgtttttggtccctgcaaatat |
42359374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 136
Target Start/End: Complemental strand, 45619795 - 45619759
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
45619795 |
ttttaggctaaaatatgtttttagtccctgcaaatat |
45619759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 47135781 - 47135833
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||| ||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
47135781 |
taaaacatgattttggtctctgtaaatatatctcgttttggttttagttcctg |
47135833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||| ||||||| || ||||||||||||| |||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 182)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 162
Target Start/End: Original strand, 1006829 - 1006892
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1006829 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1006892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 93 - 160
Target Start/End: Complemental strand, 16853601 - 16853534
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16853601 |
tattttatttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16853534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 101 - 162
Target Start/End: Original strand, 44508716 - 44508777
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44508716 |
ttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 93 - 157
Target Start/End: Complemental strand, 48359087 - 48359023
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48359087 |
tattttagttttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttc |
48359023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 18022704 - 18022654
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18022704 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
18022654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 6108334 - 6108391
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6108334 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
6108391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 19561153 - 19561206
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19561153 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc |
19561206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 100 - 153
Target Start/End: Original strand, 32189071 - 32189124
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32189071 |
tttttggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 44509054 - 44508997
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44509054 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
44508997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 7431949 - 7432001
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7431949 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
7432001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 21554391 - 21554443
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21554391 |
ttggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt |
21554443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 10358001 - 10358056
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10358001 |
ggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctg |
10358056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 12894402 - 12894347
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12894402 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
12894347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13770081 - 13770026
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13770081 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 17999721 - 17999666
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17999721 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
17999666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19757748 - 19757803
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19757748 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19757803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 28911906 - 28911851
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28911906 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28911851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 37372904 - 37372849
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37372904 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctg |
37372849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 21223405 - 21223455
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
21223455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 30709644 - 30709594
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30709644 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
30709594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 46304086 - 46304136
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46304086 |
ggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagt |
46304136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 96 - 153
Target Start/End: Original strand, 31732092 - 31732149
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31732092 |
tttattattggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 35015220 - 35015163
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
35015220 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
35015163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 95 - 160
Target Start/End: Complemental strand, 35104305 - 35104240
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35104305 |
ttttattttaggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35104240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 39833238 - 39833181
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
39833238 |
ttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
39833181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 45021856 - 45021799
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
45021856 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttcatggt |
45021799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 152
Target Start/End: Original strand, 6589016 - 6589068
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
6589016 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
6589068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 8555799 - 8555751
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8555799 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 10358369 - 10358313
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
10358369 |
tggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
10358313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 13769772 - 13769824
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13769772 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
13769824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 23399607 - 23399667
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23399607 |
ttttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 95 - 155
Target Start/End: Original strand, 23816660 - 23816720
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23816660 |
ttttatattaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagt |
23816720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 25988376 - 25988440
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25988376 |
tttattttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 39832901 - 39832961
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
39832901 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39832961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 1614904 - 1614849
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1614904 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3975549 - 3975604
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3975549 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 155
Target Start/End: Complemental strand, 3975847 - 3975788
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3975847 |
tttaatttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
3975788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 6509208 - 6509263
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
6509208 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 6509470 - 6509415
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
6509470 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
6509415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 8144658 - 8144603
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8144658 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 9659689 - 9659634
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9659689 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 17999465 - 17999512
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 19561450 - 19561395
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 20388274 - 20388329
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
20388274 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20388329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 23676452 - 23676397
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23676452 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 25547494 - 25547435
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
25547494 |
ttttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25547435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25988749 - 25988694
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25988749 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 26878071 - 26878016
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26878071 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 28911577 - 28911632
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
28911577 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
28911632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 29198662 - 29198607
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29198662 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 194
Target Start/End: Original strand, 30352563 - 30352649
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggtnnnnnnnnntattgtttttcgtccctgcaaaa |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||| |||||| | ||||||||||||||||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctggtaatttttttttttgtttttcgtccctgcaaaa |
30352649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 30709328 - 30709375
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagt |
30709375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 35210515 - 35210460
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
35210460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 44344789 - 44344734
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44344789 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
44344734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 45073641 - 45073586
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45073641 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45073586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 45228918 - 45228863
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45228918 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 46759942 - 46759887
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 48192488 - 48192433
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48192488 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 6079810 - 6079864
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
6079864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 21223748 - 21223698
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21223748 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
21223698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 30352905 - 30352847
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
30352905 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
30352847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 31310365 - 31310415
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31310365 |
ggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagt |
31310415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 95 - 160
Target Start/End: Complemental strand, 41054247 - 41054181
Alignment:
| Q |
95 |
ttttattttt-ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
41054247 |
ttttatttttaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 1614549 - 1614614
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| | |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1614549 |
ttttattataggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 14739004 - 14738947
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
14739004 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
14738947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 159
Target Start/End: Original strand, 18022368 - 18022421
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcct |
18022421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 20388681 - 20388620
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||||| |||||||| ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
20388681 |
atttatggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctg |
20388620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 25547256 - 25547305
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagttc |
25547305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
32189335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 44403252 - 44403199
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
44403252 |
tttggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
44403199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 45021493 - 45021550
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgtttt-ggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
45021493 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 100 - 153
Target Start/End: Original strand, 45073309 - 45073362
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45073309 |
ttttaggctaaaatatggttttagtccctgcaaataagcctcgttttggtttta |
45073362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 1974008 - 1974064
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
1974008 |
tggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
1974064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 5354763 - 5354823
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
5354763 |
ttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 27037592 - 27037648
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
27037592 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 35838342 - 35838282
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35838342 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35838282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 159
Target Start/End: Original strand, 38486472 - 38486532
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
38486472 |
attttaggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcct |
38486532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 46648715 - 46648667
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46648715 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 48192260 - 48192312
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 489072 - 489017
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
489072 |
ggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg |
489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 1007230 - 1007179
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
1007230 |
tggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagt |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 1559705 - 1559650
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
1559705 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctg |
1559650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 2945845 - 2945790
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
2945845 |
ggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg |
2945790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 5233808 - 5233863
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
5233808 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 5308686 - 5308632
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
5308686 |
ggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctg |
5308632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 8144295 - 8144350
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8144295 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 12932783 - 12932728
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
12932783 |
ggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg |
12932728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 14738603 - 14738650
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagt |
14738650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 16941056 - 16940997
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
16941056 |
ttttggataaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16940997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 155
Target Start/End: Complemental strand, 18891578 - 18891515
Alignment:
| Q |
92 |
gtattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| ||||||| ||||||||| |||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
18891578 |
gtattttttttttggttaaaatatggttttagtccctgcaaatatgtctcgttttaattttagt |
18891515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 21554753 - 21554698
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||| ||||||| |||| |
|
|
| T |
21554753 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctg |
21554698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 23399976 - 23399921
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
23399976 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25092160 - 25092215
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25092160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25092548 - 25092493
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
25092548 |
ggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 27458399 - 27458454
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27458399 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35104078 - 35104133
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35104078 |
ggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35665877 - 35665932
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
35665877 |
ggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg |
35665932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
| Q |
109 |
aaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
37372492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 39719352 - 39719403
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
39719352 |
tggctaaaatatggttttagtccctacaaatatgcctcattttggttttagt |
39719403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 39719642 - 39719587
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
39719642 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg |
39719587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 44402960 - 44403015
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
44402960 |
ggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg |
44403015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 44958506 - 44958451
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
44958506 |
ggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg |
44958451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 46759653 - 46759708
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
46759653 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
46759708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 5308320 - 5308378
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| |||||||| |||||||| |||| |
|
|
| T |
5308320 |
tttggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
5308378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 19783815 - 19783865
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19783815 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagt |
19783865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 98 - 160
Target Start/End: Original strand, 23676125 - 23676187
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| || ||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
23676125 |
tattttaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 30223795 - 30223745
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
30223795 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagt |
30223745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 151
Target Start/End: Complemental strand, 31310679 - 31310633
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
31310679 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 35837924 - 35837974
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
35837924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35837974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 39438741 - 39438791
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
39438741 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
39438791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 156
Target Start/End: Complemental strand, 41365213 - 41365163
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagtt |
41365163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 48852444 - 48852494
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
48852444 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagt |
48852494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 31732451 - 31732402
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
31732451 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 43300613 - 43300662
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagt |
43300662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 46304386 - 46304329
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
46304386 |
ttggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctg |
46304329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 1559343 - 1559391
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1559343 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 6847117 - 6847069
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
6847069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 101 - 153
Target Start/End: Complemental strand, 6911251 - 6911199
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||||| |||| || ||||||||||| |||||||||||||||| |
|
|
| T |
6911251 |
ttttggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 11766920 - 11766964
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
11766964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 11767280 - 11767220
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
11767280 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg |
11767220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 28262713 - 28262761
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
28262713 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
28262761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 91 - 155
Target Start/End: Complemental strand, 31503797 - 31503733
Alignment:
| Q |
91 |
agtattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||| |||| | ||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
31503797 |
agtatttttttttagcttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
31503733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 35210177 - 35210237
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
35210177 |
ttttaggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg |
35210237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 45671217 - 45671269
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctg |
45671269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3807864 - 3807919
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
3807864 |
ggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 5234204 - 5234149
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
5234204 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
5234149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 5355114 - 5355067
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagt |
5355067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 6589271 - 6589224
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagt |
6589224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 16940762 - 16940817
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
16940762 |
ggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg |
16940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 153
Target Start/End: Original strand, 18311581 - 18311628
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 22539930 - 22539985
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
22539930 |
ggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 23817034 - 23816979
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||| ||||||||||| |||||||||| |
|
|
| T |
23817034 |
ggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctg |
23816979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 29198303 - 29198358
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
29198303 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30223461 - 30223516
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
30223461 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 38186761 - 38186710
Alignment:
| Q |
105 |
ggctaaaatatgattttag-tccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
38186761 |
ggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt |
38186710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 39439029 - 39438974
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
39439029 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 41053842 - 41053897
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||| ||||||| |||| |
|
|
| T |
41053842 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 44568326 - 44568381
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44568326 |
ggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 44568690 - 44568635
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
44568690 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 46828944 - 46828999
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
46828944 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 48854070 - 48854015
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
48854070 |
ggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg |
48854015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 118 - 160
Target Start/End: Complemental strand, 1271586 - 1271544
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1271586 |
ttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1271544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 14543710 - 14543760
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
14543710 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
14543760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 97 - 155
Target Start/End: Original strand, 20355400 - 20355458
Alignment:
| Q |
97 |
ttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| ||||||||||||||||| ||| |||||||||| |||||||||||| |||| |
|
|
| T |
20355400 |
ttattttaggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagt |
20355458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 38186369 - 38186415
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttag |
38186415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 153
Target Start/End: Original strand, 12894056 - 12894089
Alignment:
| Q |
120 |
ttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggtttta |
12894089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 35470286 - 35470225
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||| || |||| |||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
35470286 |
attttaggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg |
35470225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 18311938 - 18311890
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
18311938 |
ctaaaatatgattttaatccctctaaatatgcctcgttttgattttagt |
18311890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 18927093 - 18927041
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
18927093 |
ttggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagt |
18927041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 19758044 - 19758004
Alignment:
| Q |
120 |
ttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccctg |
19758004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 34878125 - 34878077
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
34878125 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg |
44841411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 46829313 - 46829257
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
46829313 |
tggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg |
46829257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 7432249 - 7432202
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||| | |||||||||||||||||||||| ||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagt |
7432202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 9659355 - 9659410
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
9659355 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 19465980 - 19465926
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
19465980 |
ggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctg |
19465926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 24717533 - 24717482
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||| |||||| | |||||| ||||||||||||||||| |
|
|
| T |
24717533 |
tggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagt |
24717482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 26877678 - 26877733
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| || ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26877678 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 34877777 - 34877824
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| ||||||| ||||||| ||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagt |
34877824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 35469879 - 35469930
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
35469879 |
tggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagt |
35469930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 37527426 - 37527367
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||| |||| |||||| |||||||| || |||||||||||||| |||| |
|
|
| T |
37527426 |
tttttgctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg |
37527367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 37953048 - 37953001
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagt |
37953001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 39520398 - 39520453
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||| | |||||||| ||||||||||||||||| |||| |
|
|
| T |
39520398 |
ggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 41364884 - 41364939
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| || || |||||||| ||||||||||||||||| |||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctg |
41364939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 45228615 - 45228670
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| | ||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
45228615 |
ggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 155
Target Start/End: Original strand, 6954862 - 6954908
Alignment:
| Q |
109 |
aaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagt |
6954908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 155
Target Start/End: Original strand, 24953828 - 24953870
Alignment:
| Q |
113 |
tatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagt |
24953870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 28529212 - 28529162
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
||||| ||||||||| |||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
28529212 |
tttggttaaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 38486790 - 38486740
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||| ||||||||||||||| |
|
|
| T |
38486790 |
ggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagt |
38486740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 160
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 155
Target Start/End: Complemental strand, 3808106 - 3808069
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagt |
3808069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 136
Target Start/End: Complemental strand, 5611576 - 5611535
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
5611576 |
ttttaatttaggctaaaatatgattttggtccctgcaaatat |
5611535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 153
Target Start/End: Original strand, 8555598 - 8555655
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||||| || |||||||||||| |
|
|
| T |
8555598 |
tttattttaggctaaaatatagttttagtttctgcaaatatgacttgttttggtttta |
8555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 131 - 160
Target Start/End: Complemental strand, 22540265 - 22540236
Alignment:
| Q |
131 |
aaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22540265 |
aaatatgcctcgttttggttttagttcctg |
22540236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 24954147 - 24954098
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
||||||||| | |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
24954147 |
taaaatatggtcttagaccctgcaaatatgattcgttttggttttagttc |
24954098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 137
Target Start/End: Original strand, 36748193 - 36748230
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatg |
137 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
36748193 |
tttttggctaaaatatgtttttggtccctgcaaatatg |
36748230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 37952671 - 37952724
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| || ||||||||||||| |||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctg |
37952724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 43058752 - 43058805
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||||| ||||||| |||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctg |
43058805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 151
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
111 |
aatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 137
Target Start/End: Complemental strand, 36687263 - 36687231
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatg |
137 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
36687263 |
ggctaaaatatgattttggtccctgcaaatatg |
36687231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 44344457 - 44344505
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||| ||||||| ||||||| |
|
|
| T |
44344457 |
ggctaaaatatggttttagttcccgcaaatatgtctcgtttcggtttta |
44344505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 93 - 162
Target Start/End: Original strand, 8534 - 8604
Alignment:
| Q |
93 |
tattttattttt-ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8534 |
tattttattttaaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 178)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 10776501 - 10776444
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10776501 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10776444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 33526418 - 33526357
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33526418 |
attttaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
33526357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 14495069 - 14495124
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14495069 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 19494119 - 19494176
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19494119 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggt |
19494176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 19494413 - 19494356
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19494413 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
19494356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 22917564 - 22917621
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22917564 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22917621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 38930664 - 38930607
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38930664 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggt |
38930607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 2728602 - 2728542
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2728602 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 10873289 - 10873225
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
10873289 |
tttatttttggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 16789370 - 16789314
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16789370 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16789314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 35097697 - 35097637
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35097697 |
tttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 40066829 - 40066765
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
40066829 |
tttatatttggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg |
40066765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 40844147 - 40844211
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
40844147 |
tttatctttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
40844211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 7272755 - 7272696
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7272755 |
ttttggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 14239080 - 14239025
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14239080 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 16789075 - 16789130
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16789075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24187897 - 24187842
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
24187897 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25131111 - 25131166
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25131111 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
25131166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 27341591 - 27341536
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27341591 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27341536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 40066497 - 40066552
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40066497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg |
40066552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 43477163 - 43477218
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43477163 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
43477218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 1525809 - 1525859
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1525809 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1525859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 5357423 - 5357473
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5357423 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
5357473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 32418318 - 32418368
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32418318 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32418368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 1526172 - 1526115
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1526172 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggt |
1526115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 153
Target Start/End: Original strand, 4375691 - 4375740
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4375691 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 11019863 - 11019802
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11019863 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 16643661 - 16643718
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
16643661 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
16643718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 16644044 - 16643987
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16644044 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggt |
16643987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 28346764 - 28346703
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28346764 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 38930302 - 38930359
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
38930302 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggt |
38930359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 7326422 - 7326366
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7326422 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 14489078 - 14489018
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14489078 |
tttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14489018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 25131449 - 25131397
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25131449 |
ttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
25131397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
28497564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 33652193 - 33652241
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtt |
33652241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 42133159 - 42133099
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42133159 |
tttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 1685117 - 1685164
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1685164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 2728232 - 2728287
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
2728232 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 106 - 153
Target Start/End: Original strand, 4016906 - 4016953
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 4017300 - 4017245
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4017300 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 4710220 - 4710165
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4710220 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 6469280 - 6469335
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6469280 |
ggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 9496341 - 9496396
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9496341 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 11976373 - 11976428
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11976373 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11976428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 14238751 - 14238806
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
14238751 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14238806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 24955015 - 24954960
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24955015 |
ttttaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagt |
24954960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25600230 - 25600285
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25600230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 28346394 - 28346449
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28346394 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 28399035 - 28398980
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
28399035 |
ggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg |
28398980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 29158354 - 29158409
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
29158354 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
29158409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 29488110 - 29488055
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
29488110 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
29488055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 32726271 - 32726216
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32726271 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 34963300 - 34963355
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34963300 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 98 - 153
Target Start/End: Complemental strand, 35345624 - 35345569
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||| |||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35345624 |
tattttaggctaaaatatggttttagttcctgcaaatatgcctcgttttggtttta |
35345569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 37536086 - 37536141
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37536086 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 37536423 - 37536364
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
37536423 |
ttttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 44997931 - 44997986
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44997931 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctg |
44997986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 1162908 - 1162966
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
1162908 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggt |
1162966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 6146948 - 6146894
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
6146894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 7186007 - 7185949
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7186007 |
tttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 7272420 - 7272470
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7272420 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
7272470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 8094841 - 8094791
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8094841 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
8094791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 101 - 155
Target Start/End: Original strand, 15719652 - 15719706
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15719652 |
ttttggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagt |
15719706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 18549201 - 18549251
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18549201 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
18549251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 28497255 - 28497305
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28497255 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagt |
28497305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 33636322 - 33636372
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33636322 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
33636372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 34963667 - 34963609
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
34963667 |
tttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 1778562 - 1778619
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1778562 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 3511900 - 3511961
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
3511900 |
attttaggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 5357762 - 5357713
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagt |
5357713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 6146517 - 6146566
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
6146566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 8094479 - 8094536
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
8094479 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggt |
8094536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 8298577 - 8298642
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| || ||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8298577 |
ttttaattatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 13232563 - 13232510
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13232563 |
tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttc |
13232510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 24090487 - 24090438
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
24090438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 100 - 153
Target Start/End: Original strand, 42132859 - 42132912
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
42132859 |
tttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
42132912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 4621355 - 4621299
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4621355 |
tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4621299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 95 - 155
Target Start/End: Complemental strand, 9175381 - 9175321
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| || ||||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
9175381 |
ttttattttaggttaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt |
9175321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 10337114 - 10337174
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10337114 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10337174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 10755528 - 10755480
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 21125719 - 21125767
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21125719 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
21125767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 29487748 - 29487800
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
29487748 |
ttggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagt |
29487800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 32040070 - 32040130
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
32040070 |
ttttaggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg |
32040130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 35346628 - 35346684
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35346628 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 1163279 - 1163224
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
1163279 |
tttttggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagt |
1163224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3512266 - 3512211
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3512266 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 3680801 - 3680754
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3680801 |
ggctaaaatatgattttgatccctgcaaatatgcctcgttttggtttt |
3680754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 4474044 - 4473989
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4474044 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
4473989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 7326086 - 7326141
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
7326086 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 7420230 - 7420285
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
7420230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 7420590 - 7420535
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
7420590 |
ggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg |
7420535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 8298975 - 8298920
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
8298975 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 9175012 - 9175067
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
9175012 |
ggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 9496723 - 9496668
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
9496723 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 10337449 - 10337394
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
10337449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 10540782 - 10540727
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
10540782 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
10540727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 10872915 - 10872970
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10872915 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
10872970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 11019520 - 11019575
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
11019520 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 20277692 - 20277747
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
20277692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
20277747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 20984146 - 20984201
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
20984146 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21064319 - 21064374
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
21064319 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
21064374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 22650464 - 22650519
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
22650464 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22650519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 24187569 - 24187624
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
24187569 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctg |
24187624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 32725907 - 32725962
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
32725907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 33526051 - 33526102
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
33526051 |
tggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagt |
33526102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35097328 - 35097383
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35097328 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 35346998 - 35346943
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35346998 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 40492960 - 40493015
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40492960 |
ggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg |
40493015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 1408353 - 1408303
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
1408353 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt |
1408303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 14488716 - 14488766
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14488716 |
ggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagt |
14488766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 14495389 - 14495340
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagt |
14495340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 14496816 - 14496866
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
14496816 |
ggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagt |
14496866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 20278057 - 20278007
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
20278057 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagt |
20278007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 21064684 - 21064634
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
21064684 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagt |
21064634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 93 - 159
Target Start/End: Original strand, 23939535 - 23939601
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
23939535 |
tattttataattggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcct |
23939601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 28323849 - 28323899
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| |||||||||||||||| |
|
|
| T |
28323849 |
ggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagt |
28323899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 40493158 - 40493112
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggtt |
150 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
40493158 |
tggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg |
18549518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 95 - 140
Target Start/End: Complemental strand, 21509928 - 21509883
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcct |
140 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21509928 |
tttttttttaggctaaaatatgattttagtccctgcaaatatgcct |
21509883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg |
43727150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 1408004 - 1408060
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||| ||||||| ||||| |
|
|
| T |
1408004 |
tggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctg |
1408060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 13779531 - 13779483
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttag |
13779483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 27117744 - 27117808
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||||||||||| |||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
27117744 |
tttattttaggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
27117808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 29158671 - 29158619
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29158671 |
ttggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagt |
29158619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 40844532 - 40844480
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg |
40844480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 95 - 155
Target Start/End: Complemental strand, 44998273 - 44998213
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||| |||| || || |||||||| ||||||||||||||||| |
|
|
| T |
44998273 |
ttttatttttggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt |
44998213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 4473704 - 4473759
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
4473704 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 14847828 - 14847875
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagt |
14847875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 17073807 - 17073862
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
17073807 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 17574463 - 17574408
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
17574463 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 20984510 - 20984455
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
20984510 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
20984455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 26530668 - 26530723
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
26530668 |
ggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg |
26530723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 27117976 - 27117929
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
27117976 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttt |
27117929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 35115639 - 35115592
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
35115639 |
ggctaaaatatggttttagtccctacaaatatacctcgttttggtttt |
35115592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 35143844 - 35143789
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| ||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
35143844 |
ggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 4376010 - 4375961
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
4376010 |
ggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagt |
4375961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 10540449 - 10540499
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
10540449 |
ggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagt |
10540499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| || ||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg |
15930987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 103 - 141
Target Start/End: Original strand, 28398754 - 28398792
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctc |
141 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28398754 |
ttggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 151
Target Start/End: Complemental strand, 30337217 - 30337171
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
30337217 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 42430120 - 42430070
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
42430070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 110 - 155
Target Start/End: Original strand, 24814710 - 24814755
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagt |
24814755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 24954672 - 24954728
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||| ||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
24954672 |
ggctaaaatatgattt-agtttttgtaaatatgcctcgttttggttttagttcctggt |
24954728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 13155251 - 13155203
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||||||||||||||| |
|
|
| T |
13155251 |
ggctaaaatatggtttttgttcctgcaaatatgtctcgttttggtttta |
13155203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 25702507 - 25702567
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
25702507 |
ttttaggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg |
25702567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 43727431 - 43727384
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt |
43727384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 2811778 - 2811731
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagt |
2811731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 6469667 - 6469612
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||| |||| |
|
|
| T |
6469667 |
ggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctg |
6469612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 161
Target Start/End: Original strand, 7420303 - 7420346
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
7420346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 13154886 - 13154941
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
13154886 |
ggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg |
13154941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 161
Target Start/End: Original strand, 13232271 - 13232314
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctgg |
13232314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 14848186 - 14848140
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggttttagt |
14848140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19962995 - 19963050
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| | ||||||| |||||||||| |||||||| |||||||| |||| |
|
|
| T |
19962995 |
ggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg |
19963050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 161
Target Start/End: Original strand, 20277765 - 20277808
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
20277808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 161
Target Start/End: Original strand, 21064392 - 21064435
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctgg |
21064435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 21126021 - 21125966
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
21126021 |
ggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg |
21125966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24815068 - 24815013
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
24815068 |
ggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg |
24815013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25600597 - 25600542
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
25600597 |
ggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
25600542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 28324181 - 28324126
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| || |||||||||||||| |||| |
|
|
| T |
28324181 |
ggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg |
28324126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 29991918 - 29991965
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagt |
29991965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 29992300 - 29992245
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||| |||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
29992300 |
ggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg |
29992245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 106 - 153
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||| |||||||||||| || ||||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 118 - 161
Target Start/End: Complemental strand, 42430047 - 42430004
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctgg |
42430004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 110 - 160
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
| Q |
110 |
aaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg |
3680582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 136
Target Start/End: Complemental strand, 4184041 - 4184007
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4184041 |
tttggctaaaatatgcttttagtccctgcaaatat |
4184007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 13779151 - 13779197
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
13779197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 23360735 - 23360681
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | ||||| ||| ||||||||| |
|
|
| T |
23360735 |
gctaaaatatgattttaatccctgcaaatatgttttgttttagttctagttcctg |
23360681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 28258241 - 28258191
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
28258241 |
ggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagt |
28258191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 134
Target Start/End: Original strand, 34903505 - 34903543
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaat |
134 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
34903505 |
tttatttatggctaaaatatgtttttagtccctgcaaat |
34903543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 95 - 136
Target Start/End: Complemental strand, 28998062 - 28998021
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
|||| ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
28998062 |
ttttttttttggctaaaatatgtttttggtccctgcaaatat |
28998021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 141
Target Start/End: Complemental strand, 30969718 - 30969681
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctc |
141 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
30969718 |
tggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 162
Target Start/End: Original strand, 3030389 - 3030453
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||| |||||| ||||||| |||| ||||||||||||||| ||| ||| ||||| ||||||||| |
|
|
| T |
3030389 |
tattcttggcttaaatatgcttttggtccctgcaaatatgactcatttgagttttggttcctggt |
3030453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 15719979 - 15719931
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
15719979 |
ggctaaaatataattttagtttctgcaaatatgtcttgttttggtttta |
15719931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 137
Target Start/End: Original strand, 39439924 - 39439956
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatg |
137 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
39439924 |
ggctaaaatatgattttggtccctgcaaatatg |
39439956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 162)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 28863844 - 28863783
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28863844 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 101 - 162
Target Start/End: Original strand, 29151512 - 29151573
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
29151512 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggt |
29151573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 93 - 162
Target Start/End: Original strand, 29172511 - 29172580
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29172511 |
tatttttttttttgctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 5614535 - 5614475
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5614535 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
5614475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 92 - 160
Target Start/End: Original strand, 26133170 - 26133238
Alignment:
| Q |
92 |
gtattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
26133170 |
gtattttatttatggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
26133238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 99 - 162
Target Start/End: Complemental strand, 6118505 - 6118442
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
6118505 |
atttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggt |
6118442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 28550823 - 28550882
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28550823 |
ttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28550882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 100 - 162
Target Start/End: Complemental strand, 29875730 - 29875668
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29875730 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29875668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 39379242 - 39379296
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39379296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 16038743 - 16038690
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16038743 |
tttgactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
16038690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 18633599 - 18633656
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18633599 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
18633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 18633965 - 18633904
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
18633965 |
ttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggt |
18633904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 29151851 - 29151794
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29151851 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggt |
29151794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 29172886 - 29172829
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29172886 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
29172829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 29366951 - 29366894
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29366951 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 29875400 - 29875457
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29875400 |
ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggt |
29875457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 5950171 - 5950231
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5950171 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
5950231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 29692739 - 29692799
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29692739 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29692799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 40029498 - 40029442
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40029498 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40029442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 95 - 159
Target Start/End: Original strand, 42994058 - 42994122
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
42994058 |
ttttatttttggctaaaatatggttttagtccctgcaaatatgactcgttttgattttaattcct |
42994122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 2217494 - 2217549
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2217494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2217549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 7075572 - 7075627
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7075572 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7075627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 28863510 - 28863565
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28863510 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30800494 - 30800549
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30800494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 30800850 - 30800795
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30800850 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 35167165 - 35167110
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35167165 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 36578083 - 36578028
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36578083 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
36578028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 98 - 153
Target Start/End: Complemental strand, 40038865 - 40038810
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
40038865 |
tatttttggctaaaatatgattttggtccctgcaaatatgccttgttttggtttta |
40038810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 2217854 - 2217804
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2217854 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
2217804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 4203456 - 4203506
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4203456 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 10743724 - 10743774
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10743724 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10743774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 16038377 - 16038427
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16038377 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16038427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 18046348 - 18046298
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18046348 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18046298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 25561704 - 25561762
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
25561704 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggt |
25561762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 29693090 - 29693040
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29693090 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
29693040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 152
Target Start/End: Original strand, 3850293 - 3850346
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3850293 |
atttttggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttt |
3850346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 10408928 - 10408985
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10408928 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
10408985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 15635707 - 15635650
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
15635707 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggt |
15635650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 19565837 - 19565776
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19565837 |
attttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 33336028 - 33335971
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33336028 |
ttggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
33335971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 6912496 - 6912552
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6912496 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 20985720 - 20985780
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20985720 |
tttttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 25561999 - 25561951
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25561999 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 40764406 - 40764470
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40764406 |
tttatttaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 1105148 - 1105093
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1105148 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 1381611 - 1381556
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1381611 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 5917460 - 5917405
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5917460 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 10409331 - 10409276
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10409331 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
10409276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 11799458 - 11799403
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
11799458 |
ggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg |
11799403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 155
Target Start/End: Complemental strand, 13990904 - 13990845
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13990904 |
tttatttaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagt |
13990845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 19685380 - 19685325
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19685380 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19685325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 23381950 - 23382005
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
23381950 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24443744 - 24443689
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24443744 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24443689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25779162 - 25779107
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
25779162 |
ggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 26133413 - 26133358
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26133413 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26133358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 28871994 - 28871939
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28871994 |
ggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 34125302 - 34125357
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34125302 |
ttttaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
34125357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35928064 - 35928119
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35928064 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 36577722 - 36577777
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
36577722 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36577777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 38170514 - 38170569
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38170514 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 38786159 - 38786214
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
38786159 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
38786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 40167786 - 40167841
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40167786 |
ggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40167841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 42553641 - 42553692
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
42553641 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
42553692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 293828 - 293878
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
293828 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
293878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 20660948 - 20660998
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20660948 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20660998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 23382297 - 23382247
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
23382247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 103 - 157
Target Start/End: Original strand, 38962804 - 38962858
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
38962804 |
ttggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttc |
38962858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 39379610 - 39379560
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39379610 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
39379560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 2636992 - 2636943
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
2636943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 94 - 155
Target Start/End: Original strand, 14318034 - 14318095
Alignment:
| Q |
94 |
attttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||| |||| |||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
14318034 |
atttttttttaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagt |
14318095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 35166911 - 35166960
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35166911 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 35928460 - 35928403
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35928460 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35928403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 38496782 - 38496725
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
38496782 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
38496725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 45137 - 45193
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45137 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 9179920 - 9179872
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9179920 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggtttta |
9179872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 20661316 - 20661256
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
20661316 |
tttttggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg |
20661256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 21050914 - 21050858
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
21050914 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg |
21050858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 27850372 - 27850324
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagt |
27850324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 31037741 - 31037693
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31037741 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 35609635 - 35609583
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcct |
35609583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 37271350 - 37271414
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| || |||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
37271350 |
tttatcttaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
37271414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 1104858 - 1104913
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
1104858 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
1104913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 1381247 - 1381302
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
1381247 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1381302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3850599 - 3850544
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3850599 |
ggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 4203770 - 4203715
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
4203770 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
4203715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 5917126 - 5917181
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
5917126 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 9532532 - 9532485
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
9532485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 10744054 - 10743999
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
10744054 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
10743999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 11799129 - 11799184
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
11799129 |
ggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 18046038 - 18046093
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
18046038 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 156
Target Start/End: Complemental strand, 18286741 - 18286690
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18286741 |
ggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagtt |
18286690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19565467 - 19565522
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19565467 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19685017 - 19685072
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19685017 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 20986089 - 20986034
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
20986089 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21050575 - 21050630
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||| ||||||| |||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctg |
21050630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21124913 - 21124968
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21124913 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
21124968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 24443380 - 24443435
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
24443380 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 24781989 - 24782044
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
24781989 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24782044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 27916761 - 27916714
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagt |
27916714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30888160 - 30888215
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30888215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 34125632 - 34125577
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
34125632 |
ggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
34125577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 99 - 162
Target Start/End: Complemental strand, 35166164 - 35166101
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||| ||||| |||||| |||||||||||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
35166164 |
attttaggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggt |
35166101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35876688 - 35876743
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
35876688 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 35877058 - 35877003
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
35877058 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttag |
35877003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 40764780 - 40764725
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40764780 |
ggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 2032940 - 2032890
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagt |
2032890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 5614166 - 5614216
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
5614166 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
5614216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 18258527 - 18258477
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
18258527 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
18258477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 20690733 - 20690783
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
20690733 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
20690783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 28213373 - 28213423
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
28213373 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
28213423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 6912855 - 6912802
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6912802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 95 - 160
Target Start/End: Complemental strand, 28108172 - 28108107
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| || || ||||||||| |||| |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
28108172 |
ttttatattcggttaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg |
28108107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 2636667 - 2636719
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
2636667 |
ttggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagt |
2636719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 16616370 - 16616418
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagt |
16616418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 20691094 - 20691046
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagt |
20691046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 26071613 - 26071561
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctg |
26071561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 27916452 - 27916516
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
27916452 |
tttattttatgctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg |
27916516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 28871640 - 28871692
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||||||||||||| |||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg |
28871692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 35609302 - 35609358
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
35609302 |
tggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 40029141 - 40029189
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
40029141 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggtttta |
40029189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 1286682 - 1286737
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| | || |||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg |
1286737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 4736542 - 4736487
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
4736542 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 9179593 - 9179648
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
9179593 |
ggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg |
9179648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 10830529 - 10830584
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
10830529 |
ggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 12144907 - 12144962
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
12144907 |
ggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 15916281 - 15916336
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
15916281 |
tttttggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagt |
15916336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 18258162 - 18258217
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
18258162 |
ggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 20683747 - 20683802
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| |||||||| ||||||| |||| |
|
|
| T |
20683747 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg |
20683802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 160
Target Start/End: Original strand, 29855609 - 29855668
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||||||| |||| || ||||||||||| ||||||||||||| |||| |
|
|
| T |
29855609 |
ttttagctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg |
29855668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 37271706 - 37271651
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
37271706 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 40168008 - 40167953
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
40168008 |
ggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
40167953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 42207242 - 42207297
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
42207242 |
ggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctg |
42207297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 9588611 - 9588561
Alignment:
| Q |
106 |
gctaaaatatgattttag-tccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagt |
9588561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 15635379 - 15635433
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || |||||||||||||| |||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggt |
15635433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 103 - 157
Target Start/End: Original strand, 36973351 - 36973405
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||||||||||| |||| ||| || |||||||| ||||||||||||||||||| |
|
|
| T |
36973351 |
ttggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttc |
36973405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 96 - 137
Target Start/End: Complemental strand, 6244450 - 6244409
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatg |
137 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
6244450 |
tttatttttgactaaaatatgattttggtccctgcaaatatg |
6244409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 17070863 - 17070814
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| |||||||| ||||||| |
|
|
| T |
17070863 |
ggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttag |
17070814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| ||||||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctg |
42207518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 42596819 - 42596762
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||| |||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
42596819 |
ttggttaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
42596762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 1287042 - 1286990
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 5104002 - 5103950
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||||||| |||| || |||||||||||| ||| |||||||||||||| |
|
|
| T |
5104002 |
tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtt |
5103950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 31037397 - 31037445
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagt |
31037445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 40038494 - 40038542
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| ||||| |
|
|
| T |
40038494 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3851329 - 3851274
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| ||||||||| ||||||| |||| |
|
|
| T |
3851329 |
ggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctg |
3851274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 5103647 - 5103702
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
|||||||||||||||||| || | || ||||||| ||||||||||||||| ||||| |
|
|
| T |
5103647 |
tggctaaaatatgattttggttcatgtaaatatgactcgttttggttttaattcct |
5103702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 5904008 - 5904063
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
5904008 |
ggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg |
5904063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 112 - 162
Target Start/End: Original strand, 6118139 - 6118190
Alignment:
| Q |
112 |
atatgattttagtccctgcaaatatgcctcgtttt-ggttttagttcctggt |
162 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctggt |
6118190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 96 - 155
Target Start/End: Original strand, 10461334 - 10461393
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| | || ||||||||||||| |
|
|
| T |
10461334 |
tttatttttggcttaaatatgaaaatagtccctgcaaatatccgtcattttggttttagt |
10461393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 10830897 - 10830846
Alignment:
| Q |
105 |
ggctaaaatatgattttag-tccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
10830897 |
ggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagt |
10830846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24782274 - 24782220
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||||||||||| ||||||| |||| |
|
|
| T |
24782274 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctg |
24782220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
| Q |
109 |
aaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||| |||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg |
32888742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 36973710 - 36973655
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||||||||| ||||||| |||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 151
Target Start/End: Original strand, 20416360 - 20416406
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||| |||||||| |
|
|
| T |
20416360 |
ggctaaaatatggttttcgtccctgcaaatatgtctcgctttggttt |
20416406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 152
Target Start/End: Original strand, 28213446 - 28213480
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
28213446 |
ttttggtccctgcaaatatgcctcgttttggtttt |
28213480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 153
Target Start/End: Complemental strand, 38452394 - 38452348
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 38555083 - 38555034
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
38555083 |
ggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagt |
38555034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 152
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 108 - 153
Target Start/End: Original strand, 18286431 - 18286476
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||| ||||||| |||||||||||| || |||||||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggtttta |
18286476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 31602221 - 31602258
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagt |
31602258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 145
Target Start/End: Original strand, 17070535 - 17070575
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttt |
145 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||| |
|
|
| T |
17070535 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttt |
17070575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 32108808 - 32108856
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
32108808 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttagtttta |
32108856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 136)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 30929045 - 30928989
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30929045 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30928989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 494400 - 494455
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
494400 |
tttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
494455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 95 - 162
Target Start/End: Complemental strand, 1890462 - 1890395
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1890462 |
ttttattttaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
1890395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 7156160 - 7156103
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7156160 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7156103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 8680775 - 8680832
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8680775 |
ggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
8680832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 100 - 157
Target Start/End: Complemental strand, 11129548 - 11129491
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
11129548 |
tttttggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttc |
11129491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 15076204 - 15076147
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15076204 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
15076147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 15962391 - 15962334
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15962391 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15962334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 24274131 - 24274074
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24274131 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
24274074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 33801743 - 33801686
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33801743 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
33801686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 106 - 162
Target Start/End: Original strand, 31166871 - 31166927
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
31166927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 34582528 - 34582584
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34582528 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
34582584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 12299140 - 12299085
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12299140 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 97 - 156
Target Start/End: Complemental strand, 19321139 - 19321080
Alignment:
| Q |
97 |
ttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19321139 |
ttattttaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtt |
19321080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 20467718 - 20467663
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20467718 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 24273828 - 24273883
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24273828 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 95 - 162
Target Start/End: Complemental strand, 31167210 - 31167143
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
31167210 |
ttttttttttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggt |
31167143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 11448537 - 11448587
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11448537 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
11448587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 103 - 153
Target Start/End: Complemental strand, 19296409 - 19296359
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19296409 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 543365 - 543418
Alignment:
| Q |
109 |
aaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
543418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 777677 - 777734
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
777677 |
ggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggt |
777734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 7155797 - 7155854
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7155797 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
7155854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 8681116 - 8681059
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
8681116 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
8681059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 12419938 - 12419881
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12419938 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
12419881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 14655379 - 14655436
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
14655379 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
14655436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 22822651 - 22822594
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
22822651 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggt |
22822594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 32885673 - 32885730
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32885673 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
32885730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 21995434 - 21995370
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
21995434 |
tttatatttggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg |
21995370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 99 - 155
Target Start/End: Original strand, 24901233 - 24901289
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
24901233 |
atttttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
24901289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 1007509 - 1007454
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1007509 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 3356495 - 3356448
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3356448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3414387 - 3414442
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3414387 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3969009 - 3968954
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3969009 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3968954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 5286949 - 5286894
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggt |
5286894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 97 - 160
Target Start/End: Complemental strand, 12176651 - 12176588
Alignment:
| Q |
97 |
ttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12176651 |
ttattttaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
12176588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 15962027 - 15962082
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
15962027 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 17771910 - 17771961
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17771910 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
17771961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 21994403 - 21994348
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21994403 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21995064 - 21995119
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
21995064 |
ggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg |
21995119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 22543354 - 22543409
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22543354 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25137357 - 25137302
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25137357 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 25431854 - 25431799
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25431854 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
25431799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 30239292 - 30239343
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
30239292 |
tggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagt |
30239343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30928681 - 30928736
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
30928681 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
30928736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 34582892 - 34582837
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
34582892 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 2615872 - 2615922
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2615872 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagt |
2615922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 3356142 - 3356192
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3356142 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
3356192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 12419708 - 12419758
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12419708 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
12419758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 14428651 - 14428705
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
14428705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 98 - 160
Target Start/End: Complemental strand, 19129527 - 19129465
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
19129527 |
tattttaggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg |
19129465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 22792899 - 22792849
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
22792899 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagt |
22792849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
23770216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 31398541 - 31398491
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
31398541 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagt |
31398491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 543724 - 543667
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||| | |||||| |
|
|
| T |
543724 |
ggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggt |
543667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 778042 - 777985
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
778042 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtttctggt |
777985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 6412212 - 6412273
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
6412212 |
attttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 33808620 - 33808677
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
33808620 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
33808677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 34989962 - 34990011
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagt |
34990011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 1007119 - 1007179
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
1007119 |
ttttaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 7324189 - 7324137
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
7324137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 12612364 - 12612304
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| | ||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
12612364 |
ttttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctg |
12612304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 23502540 - 23502492
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23502540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
23502492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 34990312 - 34990260
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
34990260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 153
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 2373179 - 2373234
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
2373179 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg |
2373234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 2616240 - 2616193
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2616240 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3968645 - 3968700
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3968645 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 6412579 - 6412524
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
6412579 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 6468310 - 6468365
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| | |||||||||||||| |||| |
|
|
| T |
6468310 |
ggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg |
6468365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 6591115 - 6591162
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
6591115 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 6591440 - 6591385
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtttctggt |
6591385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 10910964 - 10910909
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
10910964 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10910909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 11449169 - 11449114
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
11449169 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 17765009 - 17765060
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
17765009 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtt |
17765060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19690393 - 19690448
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19690393 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21147404 - 21147459
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
21147404 |
ggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg |
21147459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21385251 - 21385306
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21385251 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 21385584 - 21385529
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
21385584 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 22543718 - 22543663
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
22543718 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 23502237 - 23502284
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
23502237 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24692979 - 24692924
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
24692979 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25136994 - 25137049
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
25136994 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg |
25137049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 33131850 - 33131795
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
33131850 |
ggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg |
33131795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 100 - 154
Target Start/End: Original strand, 317807 - 317861
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
317807 |
ttttaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttag |
317861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 1890062 - 1890116
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggt |
1890116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 3276354 - 3276304
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
3276354 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
3276304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 8170151 - 8170101
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
8170151 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
8170101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 9896637 - 9896587
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
9896637 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
9896587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 12757610 - 12757660
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
12757610 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
12757660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 13268109 - 13268159
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
13268109 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagt |
13268159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 22822307 - 22822357
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
22822307 |
ggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 102 - 155
Target Start/End: Original strand, 11925736 - 11925789
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
11925736 |
tttggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagt |
11925789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 146
Target Start/End: Complemental strand, 23770439 - 23770398
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgtttt |
146 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23770439 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 10091039 - 10091091
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
10091091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 107 - 155
Target Start/End: Complemental strand, 14428948 - 14428900
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagt |
14428900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 161
Target Start/End: Original strand, 19129336 - 19129392
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgg |
161 |
Q |
| |
|
||||| |||||| ||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19129336 |
ggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctgg |
19129392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 19267564 - 19267620
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
19267564 |
tggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 20467354 - 20467406
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 26375693 - 26375741
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
26375693 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggtttta |
26375741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 31186592 - 31186536
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| || ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
31186592 |
tggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg |
31186536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 318097 - 318042
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
318097 |
ggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg |
318042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3414752 - 3414697
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
3414752 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 103 - 158
Target Start/End: Original strand, 12611993 - 12612048
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcc |
158 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
12611993 |
ttggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcc |
12612048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 14656260 - 14656205
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
14656260 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 100 - 158
Target Start/End: Original strand, 15116668 - 15116724
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcc |
158 |
Q |
| |
|
|||| |||||||||||| |||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
15116668 |
ttttaggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagttcc |
15116724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 15442936 - 15442987
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
15442936 |
tggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 17765375 - 17765320
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
17765375 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg |
17765320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 18024375 - 18024320
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
18024375 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 19296108 - 19296163
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
19296108 |
ggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg |
19296163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 21993787 - 21993842
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
21993787 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
21993842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 97 - 160
Target Start/End: Complemental strand, 25121504 - 25121441
Alignment:
| Q |
97 |
ttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||||||| |||| || |||||||||||| |||||||||||||||| |||| |
|
|
| T |
25121504 |
ttattttaggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg |
25121441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25431576 - 25431631
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
25431576 |
ggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctg |
25431631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 155
Target Start/End: Original strand, 12298818 - 12298872
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
12298818 |
ttttggttaaaatatggttttggtccctgcaaatatgtctcgttttcgttttagt |
12298872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 118 - 160
Target Start/End: Complemental strand, 13617803 - 13617761
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13617803 |
ttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13617761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 18024008 - 18024066
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||| |||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
18024008 |
tttggataaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg |
18024066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| || | |||||||||||||||||||||||||||| |||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 155
Target Start/End: Complemental strand, 6564950 - 6564894
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||| ||||||||| || |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
6564950 |
tattttaggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagt |
6564894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 10910628 - 10910684
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||| || |||||||| ||||||||||||||||| |||| |
|
|
| T |
10910628 |
tggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg |
10910684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 141
Target Start/End: Complemental strand, 15117040 - 15117004
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctc |
141 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15117040 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
15117004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 13150750 - 13150695
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13150750 |
ggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24901554 - 24901499
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| || ||||||||||||| |||| |
|
|
| T |
24901554 |
ggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctg |
24901499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 1214996 - 1214946
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
1214996 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagt |
1214946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 19320769 - 19320815
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
19320815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 99 - 148
Target Start/End: Original strand, 1875496 - 1875545
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttgg |
148 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
1875496 |
attttaggctaaaatatagctttaatccctgcaaatatgcctcgttttgg |
1875545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 6564595 - 6564632
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
6564595 |
ttttggtccctgcaaatatgtctcgttttggttttagt |
6564632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 9896280 - 9896333
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||| |||| |||||||| |||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctg |
9896333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 155
Target Start/End: Complemental strand, 19275223 - 19275186
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagt |
19275186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 23628799 - 23628848
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
23628848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 157
Target Start/End: Complemental strand, 11926033 - 11925981
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||||||||| |||| ||| ||| ||||||| | ||||||||||||||||| |
|
|
| T |
11926033 |
ggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttc |
11925981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 12757936 - 12757888
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggtttta |
12757888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 19276036 - 19275984
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||| ||||||||||||| |||| |
|
|
| T |
19276036 |
taaaatatagttttagtccctacaaatatacctcattttggttttagtccctg |
19275984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 147
Target Start/End: Complemental strand, 19690761 - 19690717
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttg |
147 |
Q |
| |
|
||||| |||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
19690761 |
ttggcgaaaatatggttttggtccctgcaaatatgtctcgttttg |
19690717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtt |
150 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| ||| |||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 209)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 21159822 - 21159762
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21159822 |
ttttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
21159762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 29445953 - 29446009
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29445953 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29446009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30268505 - 30268560
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30268505 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 45320979 - 45320924
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45320979 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
45320924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 10976977 - 10977035
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10976977 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
10977035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 3152111 - 3152054
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3152111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
3152054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 4513253 - 4513318
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4513253 |
ttttatttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4513318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 101 - 162
Target Start/End: Original strand, 8510210 - 8510271
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
8510210 |
ttttggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggt |
8510271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 9261787 - 9261844
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9261787 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
9261844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 20612898 - 20612841
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20612898 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
20612841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 28427608 - 28427551
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28427608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
28427551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 29955672 - 29955611
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29955672 |
attttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 160
Target Start/End: Complemental strand, 30004827 - 30004766
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30004827 |
attttaggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 37506867 - 37506924
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37506867 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
37506924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 39437109 - 39437052
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39437109 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
39437052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 44802280 - 44802337
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44802280 |
ttggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 51834608 - 51834665
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51834608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
51834665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 99 - 155
Target Start/End: Original strand, 3151744 - 3151800
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3151744 |
attttaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3151800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 16123134 - 16123194
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
16123134 |
tttttggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
16123194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 106 - 162
Target Start/End: Complemental strand, 22156292 - 22156236
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggt |
22156236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 25710871 - 25710815
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25710871 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
25710815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 4950037 - 4950092
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4950037 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4950092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 20757403 - 20757450
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
20757450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 101 - 160
Target Start/End: Complemental strand, 22008894 - 22008835
Alignment:
| Q |
101 |
ttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22008894 |
ttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 30130158 - 30130213
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30130158 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
30130213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 32119584 - 32119529
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32119584 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 37507222 - 37507167
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37507222 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 45002021 - 45002076
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45002021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 275834 - 275780
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcc |
158 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
275834 |
tggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttcc |
275780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 3830516 - 3830466
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3830516 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3830466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 7957229 - 7957171
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7957229 |
tttggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg |
7957171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 100 - 162
Target Start/End: Complemental strand, 40169659 - 40169597
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
40169659 |
tttttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
40169597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 43441267 - 43441325
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43441267 |
tttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 160
Target Start/End: Original strand, 50196296 - 50196354
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50196296 |
tttgactaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 100 - 162
Target Start/End: Complemental strand, 51834947 - 51834885
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
51834947 |
ttttaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggt |
51834885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Complemental strand, 4035055 - 4034998
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4035055 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 13584367 - 13584310
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
13584367 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggt |
13584310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 15016386 - 15016443
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
15016386 |
ttggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
15016443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 26089724 - 26089785
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
26089724 |
atttttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 26799888 - 26799945
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
26799888 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggt |
26799945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 28942905 - 28942848
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28942905 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggt |
28942848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 39288898 - 39288841
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39288898 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggt |
39288841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 39436718 - 39436775
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
39436718 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
39436775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 95 - 155
Target Start/End: Complemental strand, 43440798 - 43440737
Alignment:
| Q |
95 |
ttttatttttggc-taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43440798 |
ttttatttttgccctaaaatataattttagtccctgcaaatatgcctcgttttggttttagt |
43440737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 155
Target Start/End: Original strand, 46186410 - 46186459
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagt |
46186459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 31480505 - 31480445
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31480505 |
tttttggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 40370284 - 40370340
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
40370284 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 49323781 - 49323837
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49323781 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
49323837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 474408 - 474353
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
474408 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 3830134 - 3830189
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
3830134 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
3830189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 5345689 - 5345634
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
5345689 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
5345634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 9863404 - 9863349
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
9863349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 14633547 - 14633594
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 22008526 - 22008581
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
22008526 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 22016044 - 22016099
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
22016044 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25615975 - 25616030
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25615975 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 28552383 - 28552328
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28552383 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 28942525 - 28942576
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28942525 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtt |
28942576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 31480136 - 31480191
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31480136 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 35177255 - 35177306
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
35177255 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtt |
35177306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 51500685 - 51500630
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51500685 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 51550082 - 51550137
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51550082 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 95 - 154
Target Start/End: Complemental strand, 51760128 - 51760069
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||| ||||| ||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
51760128 |
ttttttttttagctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 53701663 - 53701608
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 54608518 - 54608573
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54608518 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 9262155 - 9262105
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9262155 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
9262105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 20611020 - 20611070
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20611020 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
20611070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 100 - 162
Target Start/End: Original strand, 22155924 - 22155986
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
22155924 |
ttttaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggt |
22155986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 98 - 160
Target Start/End: Original strand, 30128277 - 30128339
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30128277 |
tattttaggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 98 - 160
Target Start/End: Complemental strand, 31869963 - 31869901
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
31869963 |
tattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
31869901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 34238598 - 34238648
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34238598 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
34238648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 39288573 - 39288623
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39288573 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
39288623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 40370589 - 40370539
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
40370539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 46186771 - 46186721
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46186771 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagt |
46186721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 46751271 - 46751321
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46751271 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
46751321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 47114487 - 47114537
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
47114487 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
47114537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 3361817 - 3361768
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
3361768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 10977341 - 10977284
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10977341 |
ggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggt |
10977284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 28427245 - 28427302
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
28427245 |
ggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggt |
28427302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 29955300 - 29955353
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
29955353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 30004454 - 30004507
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30004507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 4034716 - 4034772
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4034716 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 160
Target Start/End: Complemental strand, 4513629 - 4513565
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| |||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4513629 |
tttatttaaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctg |
4513565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 4814540 - 4814588
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4814540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 8940522 - 8940470
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 12673978 - 12673930
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggttttagtt |
12673930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 12740902 - 12740962
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12740902 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 15979337 - 15979393
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
15979337 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 26090079 - 26090023
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
26090079 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
26090023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 49670805 - 49670745
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccc-tgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||||| |||||| |
|
|
| T |
49670805 |
ttggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggt |
49670745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 51550451 - 51550391
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
51550451 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 275444 - 275499
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
275444 |
ggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 474044 - 474099
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
474044 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 96 - 155
Target Start/End: Original strand, 863272 - 863331
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||| ||||||||||||||||| |||| |||||||||| |||||||| |||||||| |
|
|
| T |
863272 |
tttattttaggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagt |
863331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 1721452 - 1721397
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
1721452 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 12673644 - 12673699
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12673644 |
ggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg |
12673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 12741271 - 12741216
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
12741271 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12741216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 19844581 - 19844526
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
19844581 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
19844526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 20757780 - 20757725
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
20757780 |
ttttaggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagt |
20757725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 28552021 - 28552076
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
28552021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
28552076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 29678389 - 29678338
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
29678389 |
ttggctaaaatatgattttggtccctgcaaatatgccctgttttggttttag |
29678338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 30106220 - 30106165
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
30106220 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
30106165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 93 - 160
Target Start/End: Original strand, 40545552 - 40545619
Alignment:
| Q |
93 |
tattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||| |||| |||||||||||| |||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
40545552 |
tatttttttttaggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
40545619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 43441603 - 43441548
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43441603 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 45002385 - 45002330
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
45002385 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
45002330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 47005524 - 47005469
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
47005524 |
ttttaggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagt |
47005469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 47336228 - 47336283
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
47336228 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 47336581 - 47336526
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
47336581 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47336526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 48924240 - 48924185
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
48924240 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 50196657 - 50196602
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
50196657 |
ggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg |
50196602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 54608863 - 54608808
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
54608863 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
54608808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 3387604 - 3387554
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
3387604 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagt |
3387554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 7518090 - 7518140
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7518090 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagt |
7518140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 7518444 - 7518394
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagttc |
7518394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 9603629 - 9603679
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9603629 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagt |
9603679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 11463233 - 11463287
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg |
11463287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 13514577 - 13514527
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
13514577 |
ggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagt |
13514527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 14772211 - 14772261
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
14772211 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagt |
14772261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 15286156 - 15286206
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
15286156 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagt |
15286206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 19656541 - 19656591
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
19656541 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagt |
19656591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 21159453 - 21159503
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
21159453 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
21159503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 29446206 - 29446156
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
29446206 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagt |
29446156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 29490743 - 29490693
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
29490743 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
29490693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 29525105 - 29525155
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
29525105 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagt |
29525155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 34238915 - 34238865
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
34238915 |
ggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagt |
34238865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 38232241 - 38232291
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
38232241 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagt |
38232291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 153
Target Start/End: Complemental strand, 45006247 - 45006201
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggtttta |
45006201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 99 - 153
Target Start/End: Original strand, 52342189 - 52342243
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
52342189 |
attttaggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 52342583 - 52342533
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
52342583 |
ggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagt |
52342533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 14633889 - 14633832
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
14633889 |
ggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
14633832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 21553889 - 21553938
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttag |
154 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
21553889 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttag |
21553938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 25610129 - 25610080
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
25610080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 39072214 - 39072165
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
39072214 |
tggctaaaatatggttttagttcctgcaaatatgcctcgttttgatttta |
39072165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 40169344 - 40169401
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
40169344 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggt |
40169401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 95 - 160
Target Start/End: Complemental strand, 47902155 - 47902090
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| |||||||||| | |||||||||||||| |||| |
|
|
| T |
47902155 |
ttttctttttggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctg |
47902090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 9603919 - 9603871
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
9603919 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 10778373 - 10778425
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctg |
10778425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 35569133 - 35569081
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg |
40545784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 40979710 - 40979662
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
40979710 |
ggctaaaatatggttttaatccctgcaaatatggctcgttttggtttta |
40979662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 45313864 - 45313808
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
45313864 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctg |
45313808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 162
Target Start/End: Complemental strand, 8510523 - 8510472
Alignment:
| Q |
111 |
aatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggt |
8510472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 9597095 - 9597040
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
9597095 |
ggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg |
9597040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 9863050 - 9863096
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagt |
9863096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 15979701 - 15979646
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
15979701 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
15979646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 20907454 - 20907407
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagt |
20907407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 25710510 - 25710565
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
25710510 |
ggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 28452376 - 28452321
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
28452376 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 30426227 - 30426177
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
30426227 |
tggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagt |
30426177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 30552478 - 30552423
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
30552478 |
ggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 35565508 - 35565563
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
35565508 |
ggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg |
35565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 45161116 - 45161163
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagt |
45161163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 156
Target Start/End: Original strand, 46901104 - 46901155
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
46901104 |
ggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtt |
46901155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 47005154 - 47005209
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
47005154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 51759819 - 51759874
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| || |||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
51759819 |
ggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctg |
51759874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 2486581 - 2486631
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttc |
2486631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 107 - 153
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||| |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 4814898 - 4814849
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
4814898 |
ggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagt |
4814849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 7588318 - 7588368
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
7588318 |
ggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagt |
7588368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg |
9596813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 147
Target Start/End: Original strand, 25353199 - 25353241
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttg |
147 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25353199 |
ggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 30130504 - 30130454
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
30130504 |
ggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagt |
30130454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 30424628 - 30424678
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagt |
30424678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 43440495 - 43440545
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
43440495 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagt |
43440545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 49670477 - 49670531
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||| | |||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggt |
49670531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 51500398 - 51500448
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| || ||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
51500398 |
ggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagt |
51500448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 98 - 160
Target Start/End: Original strand, 53701354 - 53701416
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| ||||| || |||||||||||||| |||| |||||||| |||| |
|
|
| T |
53701354 |
tatttttggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctg |
53701416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 155
Target Start/End: Complemental strand, 8555315 - 8555258
Alignment:
| Q |
98 |
tatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||| ||| ||||||||| |||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
8555315 |
tatttctggttaaaatatggttttggtccatgcaaatatgcatcgttttggttttagt |
8555258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 19844263 - 19844320
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||||||||||||| ||||||| |||| |
|
|
| T |
19844263 |
ttggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg |
19844320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 160
Target Start/End: Original strand, 20644495 - 20644560
Alignment:
| Q |
95 |
ttttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||||||||| ||| ||||| ||||||| |||| |
|
|
| T |
20644495 |
ttttttttttggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg |
20644560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| ||||| | |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg |
31869649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 3387268 - 3387320
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 16679678 - 16679726
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| ||||||||| || |||||||| |||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagt |
16679726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 27681682 - 27681634
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| || | ||| ||||||||||||||||||||||||||| |
|
|
| T |
27681682 |
ggctaaaatatggttctggtctctgcaaatatgcctcgttttggtttta |
27681634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 158
Target Start/End: Complemental strand, 36673244 - 36673192
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcc |
158 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcc |
36673192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 40277822 - 40277870
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||| || |||| |||||||||||||||| |||||||||||||| |
|
|
| T |
40277822 |
ggctaaaatgtggttttggtccctgcaaatatgcttcgttttggtttta |
40277870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 149
Target Start/End: Complemental strand, 44802548 - 44802504
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggt |
149 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
44802548 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 45005881 - 45005941
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
45005881 |
tttttggttaaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 45521833 - 45521781
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
45521781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 97 - 157
Target Start/End: Original strand, 52956375 - 52956435
Alignment:
| Q |
97 |
ttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||| |||||||||||||| |||| |||||| | |||||| ||||||||||||||||||| |
|
|
| T |
52956375 |
ttatatttggctaaaatatacttttggtccctactaatatgtctcgttttggttttagttc |
52956435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 157
Target Start/End: Complemental strand, 16123481 - 16123450
Alignment:
| Q |
126 |
cctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16123481 |
cctgcaaatatgcctcgttttggttttagttc |
16123450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 144
Target Start/End: Original strand, 18175791 - 18175830
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgtt |
144 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctcgtt |
18175830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 155
Target Start/End: Original strand, 28452142 - 28452197
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||| |||| |||||||||| || |||||||||||||| |
|
|
| T |
28452142 |
ttttaggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagt |
28452197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 29678024 - 29678079
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
29678024 |
ggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg |
29678079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 153
Target Start/End: Original strand, 30034104 - 30034155
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||| |||||||||| |||| |||| || ||||||||||||||||||||||| |
|
|
| T |
30034104 |
tttgactaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 30034472 - 30034417
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
30034472 |
ggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 32119220 - 32119275
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
32119220 |
ggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 151
Target Start/End: Complemental strand, 38232613 - 38232554
Alignment:
| Q |
92 |
gtattttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
||||||||||||| | || |||||| |||| || |||||||||||| ||||||||||||| |
|
|
| T |
38232613 |
gtattttatttttagttataatatggttttggtacctgcaaatatgtctcgttttggttt |
38232554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 40723121 - 40723168
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||| |||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagt |
40723168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 46622129 - 46622074
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
46622129 |
ggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 108 - 155
Target Start/End: Original strand, 47901803 - 47901850
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||||||| ||| |||||||| |||||||||||||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagt |
47901850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 50261937 - 50261886
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||||| |
|
|
| T |
50261937 |
tggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagt |
50261886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 53113443 - 53113490
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
53113443 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 143
Target Start/End: Complemental strand, 26273824 - 26273786
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgt |
143 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
26273824 |
ggctaaaatatggttttagtcccagcaaatatgcctcgt |
26273786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 155
Target Start/End: Original strand, 590197 - 590226
Alignment:
| Q |
126 |
cctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
590197 |
cctgcaaatatgcctcgttttggttttagt |
590226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 155
Target Start/End: Complemental strand, 11463480 - 11463431
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||| ||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagt |
11463431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 160
Target Start/End: Complemental strand, 14772523 - 14772470
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| ||||||| | ||||||||| |||| ||||||||||||| |||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctg |
14772470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 118 - 155
Target Start/End: Original strand, 35565581 - 35565618
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagt |
35565618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 103 - 136
Target Start/End: Original strand, 43641141 - 43641174
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatat |
136 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
43641141 |
ttggctaaaatatgcttttagtccctgcaaatat |
43641174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 863649 - 863597
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg |
863597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| |||| |||||||||| ||| ||||||||||||| |||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 4322186 - 4322134
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||| |||| ||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
4322134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 8940163 - 8940215
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| || |||||||||| |||||||||||||||||| |||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg |
8940215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 162
Target Start/End: Complemental strand, 10778706 - 10778674
Alignment:
| Q |
130 |
caaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
10778706 |
caaatatgcctcgttttggttttagtccctggt |
10778674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 137
Target Start/End: Complemental strand, 26800169 - 26800137
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatg |
137 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
26800169 |
ggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 35498416 - 35498464
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| |||||||||||||| |
|
|
| T |
35498416 |
ggctaaaatatgggtttagtccctacaaatatgattcgttttggtttta |
35498464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 35936780 - 35936828
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||||| ||||||| | |||||||||||||| |
|
|
| T |
35936780 |
ggctaaaatatggttttggtccctacaaatatacttcgttttggtttta |
35936828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 50009284 - 50009236
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||| |||| |||| |||| |||||||||||||||||||| ||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgatttta |
50009236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 12537 - 12486
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12537 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
12486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 12182 - 12237
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
12237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 1644 - 1587
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1644 |
ggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggt |
1587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 1311 - 1368
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1311 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
1368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 2778 - 2833
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2778 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 9028 - 8973
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 107 - 160
Target Start/End: Original strand, 8734 - 8787
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 48; Significance: 1e-18; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 96 - 155
Target Start/End: Original strand, 4032 - 4091
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4032 |
tttattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
4091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 96 - 155
Target Start/End: Original strand, 19214 - 19273
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19214 |
tttattttaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
19273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 4288 - 4238
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4288 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
4238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 19470 - 19420
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
19470 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagt |
19420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 14697 - 14752
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14697 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 15012 - 14957
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
15012 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
14957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 366273 - 366218
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
366273 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
366218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 365979 - 366034
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 34930 - 34988
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34930 |
tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggt |
34988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 289 - 232
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
289 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggt |
232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 5209 - 5257
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5209 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 5229 - 5277
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 103 - 151
Target Start/End: Complemental strand, 4314 - 4266
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttt |
151 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4314 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttt |
4266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 112 - 160
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
112 |
atatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 12524 - 12575
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12524 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
12575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 3531 - 3582
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3531 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
3582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3918 - 3863
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
3918 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
3863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 54815 - 54870
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
54815 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 82706 - 82651
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
82706 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 82341 - 82396
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
82341 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 75764 - 75709
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
75764 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 75353 - 75414
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
75353 |
attttaggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
75414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 10515 - 10460
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
10515 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 10168 - 10218
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
10218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 17969 - 17911
Alignment:
| Q |
102 |
tttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
17969 |
tttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
17911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 160
Target Start/End: Original strand, 17651 - 17705
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| || ||||| |||||||| |||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctg |
17705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 5399 - 5449
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5399 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
5449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 5708 - 5651
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctggt |
162 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
5708 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggt |
5651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 16722 - 16779
Alignment:
| Q |
103 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
16722 |
ttggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg |
16779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 155
Target Start/End: Complemental strand, 3461 - 3405
Alignment:
| Q |
99 |
atttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
3461 |
atttttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 160
Target Start/End: Complemental strand, 18048 - 17988
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||| |||||||||||| ||||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
18048 |
ttttaggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg |
17988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 94057 - 94105
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
94057 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 106 - 153
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
106 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 2665 - 2610
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
2665 |
ttttaggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagt |
2610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 2334 - 2382
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||| |||||| |||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
2334 |
ggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 3291 - 3236
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
3291 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
3236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 24372 - 24427
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
24372 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 24657 - 24603
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||||||||||| ||||||| |||| |
|
|
| T |
24657 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctg |
24603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 27364 - 27309
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27364 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 152
Target Start/End: Original strand, 27072 - 27106
Alignment:
| Q |
118 |
ttttagtccctgcaaatatgcctcgttttggtttt |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggtttt |
27106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Original strand, 47925 - 47980
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
47925 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 48228 - 48181
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
48181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 109 - 160
Target Start/End: Original strand, 222817 - 222868
Alignment:
| Q |
109 |
aaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctg |
222868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 100 - 155
Target Start/End: Complemental strand, 223177 - 223122
Alignment:
| Q |
100 |
tttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||| |||||||||||| |
|
|
| T |
223177 |
ttttaggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagt |
223122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 148282 - 148227
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
160 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 8330 - 8380
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
8330 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 8642 - 8592
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
8642 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 22055 - 22005
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| |||||| ||||| |||||||||||||||||||| |
|
|
| T |
22055 |
ggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagt |
22005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 7264 - 7216
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| || |||||||||||| |
|
|
| T |
7264 |
ggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 153
Target Start/End: Original strand, 3752 - 3800
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| | |||||||||||| |
|
|
| T |
3752 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggtttta |
3800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Complemental strand, 4079 - 4029
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||| | |||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
4079 |
ggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagt |
4029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 104 - 147
Target Start/End: Complemental strand, 2884 - 2841
Alignment:
| Q |
104 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttg |
147 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
2884 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
2841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 105 - 155
Target Start/End: Original strand, 2501 - 2551
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
155 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
2501 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagt |
2551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 157
Target Start/End: Original strand, 189320 - 189381
Alignment:
| Q |
96 |
tttatttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttc |
157 |
Q |
| |
|
|||||| | ||||||||||| |||| | |||| ||||||||||||||||||||||||||| |
|
|
| T |
189320 |
tttattataggctaaaatatagttttgattcctgtaaatatgcctcgttttggttttagttc |
189381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 189678 - 189630
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
||||||||||| |||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
189678 |
ggctaaaatatagtttttgtcgctgcaaatatgcctcattttggtttta |
189630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 108 - 156
Target Start/End: Complemental strand, 5067 - 5019
Alignment:
| Q |
108 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtt |
156 |
Q |
| |
|
||||||||| |||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagtt |
5019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 17126 - 17178
Alignment:
| Q |
107 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcct |
159 |
Q |
| |
|
|||||||||| |||| |||||| |||||||| | |||||||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagttcct |
17178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 153
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
105 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
153 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| || ||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University