View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_87 (Length: 236)
Name: NF1148_low_87
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_87 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 5828918 - 5828805
Alignment:
| Q |
1 |
tctttattgacgatgtatttgaattttttggttgctcctctttattagttcctctctctattagacggttggttcttctctttggttattgtgtcttctt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5828918 |
tctttattgatgatgtatttgaatttttttgttgctcctctttattagttcctctctctattagacagttggttcttctctttggttattgtgtcttctt |
5828819 |
T |
 |
| Q |
101 |
ttattgttcatctc |
114 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
5828818 |
ttattgttcttctc |
5828805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University