View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_90 (Length: 213)
Name: NF1148_low_90
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_90 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 8641773 - 8641898
Alignment:
| Q |
1 |
gaccggcgccacaaaaagaagctgctcctggtcttgcatactttcacatccccttgccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8641773 |
gaccggcgccacaaaaagaagctgctcctggtcttgcatactttcacatccccttaccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaa |
8641872 |
T |
|
| Q |
101 |
aatggaaatggatggcggtgatggca |
126 |
Q |
| |
|
|||||||| || |||||||||||| |
|
|
| T |
8641873 |
aatggaaacatatagcggtgatggca |
8641898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 8648353 - 8648478
Alignment:
| Q |
1 |
gaccggcgccacaaaaagaagctgctcctggtcttgcatactttcacatccccttgccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8648353 |
gaccggcgccacaaaaagaagctgctcctggtcttgcatactttcacatccccttaccggaatatgcaagtcttgattcatcaaacatgacaggtgtgaa |
8648452 |
T |
|
| Q |
101 |
aatggaaatggatggcggtgatggca |
126 |
Q |
| |
|
|||||||| || |||||||||||| |
|
|
| T |
8648453 |
aatggaaacatatagcggtgatggca |
8648478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University