View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1148_low_91 (Length: 211)

Name: NF1148_low_91
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1148_low_91
NF1148_low_91
[»] chr5 (1 HSPs)
chr5 (18-160)||(9503301-9503444)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 9503301 - 9503444
Alignment:
18 tcattacaagtatcacatgtctagtcaataatcacacgaggatactcatcaaattagttaatagttatgtaaatgtccattacagt-ggaggatatgtgg 116  Q
    |||| |||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||    
9503301 tcatcacaagtattacatgtctagtcaataatcatacgaggatactcatcaaattagttaatagttatgtaaatgtccattatagtgggaggatatgtgg 9503400  T
117 gggcatgactcatgagtacagtttagttagttttaacttctgaa 160  Q
    |||||||||||||||||||| ||||||||||||||  |||||||    
9503401 gggcatgactcatgagtacaatttagttagttttagtttctgaa 9503444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University