View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_93 (Length: 210)
Name: NF1148_low_93
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_93 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 8441310 - 8441495
Alignment:
| Q |
18 |
atctctaaccaacagcttttttattctatcttactgcagtcgcgttttcaccacaattacaagtgatctcaatgatgataatttgatcaacaagttaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8441310 |
atctctaaccaacagcttttttattttatcttactgcagtcgcgttttgaccacaactacaagtgatctcaatgatgtcaatttgatcaacaagttaaaa |
8441409 |
T |
|
| Q |
118 |
gacaaccaaagcatgaaatggttgaaaagctgattccaacaccata-ggacctaaccaaaccttatattttcaatagcagtattat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
8441410 |
gacaaccaaagcatgaaatggttgaaaagttgattccaacaccatagggacctaaccaaaccttatattttcaacagcagtgttat |
8441495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 119 - 182
Target Start/End: Original strand, 8443177 - 8443242
Alignment:
| Q |
119 |
acaaccaaagcatgaaatggttg-aaaagctgattccaacaccata-ggacctaaccaaaccttat |
182 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| ||||| |||| ||||||| ||||||||||| |
|
|
| T |
8443177 |
acaaccaaagcatgaaagggttgcaaaagctgatttcaacatcatagggacctagccaaaccttat |
8443242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University