View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1148_low_95 (Length: 208)

Name: NF1148_low_95
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1148_low_95
NF1148_low_95
[»] chr4 (1 HSPs)
chr4 (18-208)||(48258606-48258796)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 48258796 - 48258606
Alignment:
18 agatccaaaccaagccttcataccaaaatcaccttccatgtaaagatagttcacaatttccactttattggcacatctagggcataaaacgtctccggcc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48258796 agatccaaaccaagccttcataccaaaatcaccttccatgtaaagatagttcacaatttccactttattggcacatctagggcataaaacgtctccggcc 48258697  T
118 aagcctttatgatttaactcactcatgacatgcatagagtcgttaagaatgtgtcataggaaatctttgtgcttaggtatagtgtggagat 208  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||    
48258696 aagcctttatgatttaactcactcatgacatgcatagagtctttaagaatgtgtcatgggaaatctttgtgcttaggtatagtgtggagat 48258606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University