View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1148_low_95 (Length: 208)
Name: NF1148_low_95
Description: NF1148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1148_low_95 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 48258796 - 48258606
Alignment:
| Q |
18 |
agatccaaaccaagccttcataccaaaatcaccttccatgtaaagatagttcacaatttccactttattggcacatctagggcataaaacgtctccggcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48258796 |
agatccaaaccaagccttcataccaaaatcaccttccatgtaaagatagttcacaatttccactttattggcacatctagggcataaaacgtctccggcc |
48258697 |
T |
 |
| Q |
118 |
aagcctttatgatttaactcactcatgacatgcatagagtcgttaagaatgtgtcataggaaatctttgtgcttaggtatagtgtggagat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48258696 |
aagcctttatgatttaactcactcatgacatgcatagagtctttaagaatgtgtcatgggaaatctttgtgcttaggtatagtgtggagat |
48258606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University