View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11490_high_13 (Length: 290)
Name: NF11490_high_13
Description: NF11490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11490_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 278
Target Start/End: Complemental strand, 26901637 - 26901379
Alignment:
| Q |
20 |
accctgatgtggttgcagcgatcattgatcaaacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagcttt |
119 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901637 |
accctgatgtggtttcagcgatcgttgatcaaacgaaaaaattacagcactcaacggtgttgtatctgaatcatgctgttgctgattttgcggaagcttt |
26901538 |
T |
|
| Q |
120 |
ggctggtaaactccccggtgatcttaaggtaaactttgtttaacgttaccgtaatctcaattttgttactgtttagtttgatttaatagtaannnnnnna |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26901537 |
ggctggtaaactccccggtgatcttaaggtaaactttgtttaacgttaccgtaatctcaattttgttactgtttagtttgatttaatagtaattttttta |
26901438 |
T |
|
| Q |
220 |
cggaatttgattctatatagtataaatctttttcttataatcacatgctcaatggtttc |
278 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26901437 |
cggaatttgattttatgtagtataaatctttttcttataatcacatgctcaatggtttc |
26901379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University