View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11490_low_16 (Length: 261)
Name: NF11490_low_16
Description: NF11490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11490_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 51 - 251
Target Start/End: Complemental strand, 42471235 - 42471035
Alignment:
| Q |
51 |
tctttccaccaccgaatttcaccctcaacgtacgaggccgctgccacacaaatttcacttaaattttctaaagtcaataatccaactagagagggaaata |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42471235 |
tctttccaccaccgaatttcaccctcaacgtacgaggccgctgccgcacaaatttcacttaaattctctaaagtcaataatccaactagagagggaaata |
42471136 |
T |
|
| Q |
151 |
attgaacgattcgtatatattttcctaccaatggcacgtctttgcacagttctgttttagcataatgtattctatatctaatcacgctattttgttctct |
250 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42471135 |
attgaacgattcgtatatatttccctaccaatggcacgtctttgcacagttctgttttagcataatgtattctatatctaatcacgctattttgttctct |
42471036 |
T |
|
| Q |
251 |
g |
251 |
Q |
| |
|
| |
|
|
| T |
42471035 |
g |
42471035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University