View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11490_low_17 (Length: 260)
Name: NF11490_low_17
Description: NF11490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11490_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 11 - 200
Target Start/End: Complemental strand, 35582179 - 35581987
Alignment:
| Q |
11 |
cagagataaaatgaggccgataatcccacatagaccacaacaataccggatccaacggcttttgggttgagtgttgctggtgtaaaattgatcatccatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35582179 |
cagagataaaatgaggccgataatcccacatagaccacaacaataccggatccaacggcttttgggttgagtgttgctggtgtaaaattgatcatccatt |
35582080 |
T |
 |
| Q |
111 |
ggggtgagggtaataatttgcacactttggatatgtgaatgtga---aggtgttaagaaatcaatctatgaactattcaaatacatgaatatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35582079 |
ggggtgagggtaataatttgcacactttggatatgtgaatgtgaattaggtgttaagaaatcaatctatgaactattcaaatacaggaatatg |
35581987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University