View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11491_high_15 (Length: 266)
Name: NF11491_high_15
Description: NF11491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11491_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 43596610 - 43596349
Alignment:
| Q |
1 |
tcatcttctccggctccgtcgtattctcactggaagcgtctcgatgacgagtcacgaaacgttagggtttctgtttggtgggatttcgagaactgcagcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43596610 |
tcatcttctccggctccgtcgtattctcactggaagcgtctcgatgacgagtcacgaaacgttagggtttctgtgtggtgggatttcgagaactgcagcg |
43596511 |
T |
 |
| Q |
101 |
tgccggtcggccttaacgtttccagagtagccccgtcaatcactgacgccgttagagcgaacgggattaaaggtcctgttcatattactgctttcggtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596510 |
tgccggtcggccttaacgtttccagagtagccccgtcaatcactgacgccgttagagcgaacgggattaaaggtcctgttcatattactgctttcggtga |
43596411 |
T |
 |
| Q |
201 |
tgtgatgcagctttctaaatctaatcaagaatcacttgctttcactggcattcatctcactc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596410 |
tgtgatgcagctttctaaatctaatcaagaatcacttgctttcactggcattcatctcactc |
43596349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University