View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11491_low_22 (Length: 259)

Name: NF11491_low_22
Description: NF11491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11491_low_22
NF11491_low_22
[»] chr2 (1 HSPs)
chr2 (12-240)||(4861253-4861481)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 4861481 - 4861253
Alignment:
12 agagatgggtagaggaaacacaacaaaagatatagacaaaactttcatattagtgttaaaagtattggtatatcaattgagtaagagtcccacgttagaa 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||    
4861481 agagatgggtagaggaaacacaacaaaagatatagacaaaactttcatattagtgttaaaagtatttgtatatcaattgagtaagagtctcacgttagaa 4861382  T
112 gnnnnnnntgattgttaaacacattatatgtgaaatgagttataagtataatgtctacaggttttggattaaaatatgtcgtccaactcatttatatgat 211  Q
    |       |||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||    
4861381 gaaaaaaatgattgttaaacacattatatgtgaaatgacttataagtataatgtctaaaggctttggattaaaatatgtcgtccaactcacttatatgat 4861282  T
212 tgtttaaaatttgatatgatgattcttcg 240  Q
    |||||||||| ||||||||||||||||||    
4861281 tgtttaaaatctgatatgatgattcttcg 4861253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University