View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11491_low_22 (Length: 259)
Name: NF11491_low_22
Description: NF11491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11491_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 240
Target Start/End: Complemental strand, 4861481 - 4861253
Alignment:
| Q |
12 |
agagatgggtagaggaaacacaacaaaagatatagacaaaactttcatattagtgttaaaagtattggtatatcaattgagtaagagtcccacgttagaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
4861481 |
agagatgggtagaggaaacacaacaaaagatatagacaaaactttcatattagtgttaaaagtatttgtatatcaattgagtaagagtctcacgttagaa |
4861382 |
T |
|
| Q |
112 |
gnnnnnnntgattgttaaacacattatatgtgaaatgagttataagtataatgtctacaggttttggattaaaatatgtcgtccaactcatttatatgat |
211 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4861381 |
gaaaaaaatgattgttaaacacattatatgtgaaatgacttataagtataatgtctaaaggctttggattaaaatatgtcgtccaactcacttatatgat |
4861282 |
T |
|
| Q |
212 |
tgtttaaaatttgatatgatgattcttcg |
240 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
4861281 |
tgtttaaaatctgatatgatgattcttcg |
4861253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University