View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11491_low_23 (Length: 254)
Name: NF11491_low_23
Description: NF11491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11491_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 40638164 - 40637926
Alignment:
| Q |
1 |
gctacgtttggctctgacttgacccatgcaagtgactttaggggaagaaggttcttgtgtagtttcaatggnnnnnnngttacggagaacgaacatgggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40638164 |
gctacgtttggctctgacttgacccatgcaagtgactttaggggaagaaggttcttgtgtagtttcaatggtttttttgttacggagaacgaacatgggg |
40638065 |
T |
 |
| Q |
101 |
cttgaccttgaccttctactacttctacttcctgcattggttcttaagaatctcattaatggtggtggaaacttgtctgtacgtgctggacttgaaatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40638064 |
cttgaccttgaccttctactacttctacttcctgcattggttcttaagaatctcattaatggtggtggaaacttgtctgtacgtgctggacttgaaatgc |
40637965 |
T |
 |
| Q |
201 |
tttttgttgttgatagcttcatcttttttgcttcttttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40637964 |
tttttgttgttgatagcttcatcttttttgcttcttttt |
40637926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 28675726 - 28675765
Alignment:
| Q |
17 |
acttgacccatgcaagtgactttaggggaagaaggttctt |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675726 |
acttgacccatgcaagtgactttaggggaagaaggttctt |
28675765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University