View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11491_low_27 (Length: 236)
Name: NF11491_low_27
Description: NF11491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11491_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 217
Target Start/End: Complemental strand, 30789741 - 30789542
Alignment:
| Q |
18 |
agataagtgtactagagaggtcaaaaagacagccgaagtacctggttctaaaatgagtcattgtacgaaaaacttgaacaattgtcttccacaacaaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789741 |
agataagtgtactagagaggtcaaaaagacagccgaagtacctggttcaaaaatgagtcattgtacgaaaaacttgaacaattgtcttccacaacaaaat |
30789642 |
T |
|
| Q |
118 |
tgaaaatttcaacaaagaggtcaaggattcactataaaccctgttataacttagtttaaaatttaaagtaaaaagagtaacagtttttgatcttatccac |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30789641 |
tgaaaatttcaacaaagaggtcaaggattcactataaacactgttataacttagtttaaaatttaaagtaaaaagagtaacagtttttgatcttatccac |
30789542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University