View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11492_high_2 (Length: 289)
Name: NF11492_high_2
Description: NF11492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11492_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 56293435 - 56293704
Alignment:
| Q |
1 |
acttttgtctcattcttgtttttattattcaagaactgcttctacaagcatcgtcaatgggatacaataatacatgggatcttttttaacattcgatggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56293435 |
acttttgtctcattcttgtttttattattcaagtactgcttctacaagcatcgtcaatgggctacaataatacatgggatcttttttaacattcgatggt |
56293534 |
T |
 |
| Q |
101 |
ccttgattgattggttttannnnnnnggggtggtgcggtggggttggttgaagatgcattctaaatcataataactcaaggtagacagacagggacatat |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56293535 |
ccttgattgattggttttatttttttggggtggtgcggtggggttggttgaagatgcattctaaatcataataactcaaggtagacagacagggacatat |
56293634 |
T |
 |
| Q |
201 |
gtagtgagagtgacacttttgaactacacttggaattagctcaacacagagtactgctctgctccactca |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56293635 |
gtagtgagagtgacacttttgaactacacttggaattagctcaacacaaagtactgctctgctccactca |
56293704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University