View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11493_high_21 (Length: 240)
Name: NF11493_high_21
Description: NF11493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11493_high_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 122 - 240
Target Start/End: Complemental strand, 47691762 - 47691646
Alignment:
| Q |
122 |
ttaatgaagctccgccgctactttttcatcacctctgaactaacaccctattttaacaatgatatgtcgcgctatataatttactgctggctattgttta |
221 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47691762 |
ttaataaagctccgccgctacttt--catcacctctgaactaacaccctattttaacaatgatatgtcgcgctatataatttacggctggctattgttta |
47691665 |
T |
 |
| Q |
222 |
gtagtcacaacatcaattc |
240 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47691664 |
gtagtcacaacatcaattc |
47691646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University