View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11493_high_21 (Length: 240)

Name: NF11493_high_21
Description: NF11493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11493_high_21
NF11493_high_21
[»] chr3 (1 HSPs)
chr3 (122-240)||(47691646-47691762)


Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 122 - 240
Target Start/End: Complemental strand, 47691762 - 47691646
Alignment:
122 ttaatgaagctccgccgctactttttcatcacctctgaactaacaccctattttaacaatgatatgtcgcgctatataatttactgctggctattgttta 221  Q
    ||||| ||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
47691762 ttaataaagctccgccgctacttt--catcacctctgaactaacaccctattttaacaatgatatgtcgcgctatataatttacggctggctattgttta 47691665  T
222 gtagtcacaacatcaattc 240  Q
    |||||||||||||||||||    
47691664 gtagtcacaacatcaattc 47691646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University