View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11493_low_10 (Length: 380)
Name: NF11493_low_10
Description: NF11493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11493_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 237 - 380
Target Start/End: Complemental strand, 10031758 - 10031615
Alignment:
| Q |
237 |
gcttattatcagtatcttctgctcagcatgacatagatttgataaatactaatagaattttctccctgatgaactgcagaaaaaggagactgcatagctg |
336 |
Q |
| |
|
|||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10031758 |
gcttattatcagtatcttttgcttagcatggcatagatttgataaatactaatagaattttctccctgatgaactgcagaaaaaggagaccgcatagctg |
10031659 |
T |
 |
| Q |
337 |
catttatttgagagcctatccaaggggaagctggggtatgtttt |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10031658 |
catttatttgagagcctatccaaggggaagctggggtatgtttt |
10031615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University