View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11493_low_15 (Length: 294)
Name: NF11493_low_15
Description: NF11493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11493_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 6272246 - 6271975
Alignment:
| Q |
1 |
gcaactgctatacataccaccagcactgaaaagtaaaaaatgccaaaagggttttataataatgatcaagcaaggatattaattcataaaacacgaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272246 |
gcaactgctatacataccaccagcactgaaaagtaaaaaatgccaaaagggttttataataatgatcaagcaaggatattaattcataaaacacgaatgc |
6272147 |
T |
 |
| Q |
101 |
atttannnnnnnctgaacttgcataccgtgcctcttccactaaggtgaggagattcttgtttgaaagctcaaccacaattgcatatgcttctgtttcatg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272146 |
atttatttttttctgaacttgcataccgtgcctcttccactaaggtgaggagattcttgtttgaaagctcaaccacaattgcatatgcttctgtttcatg |
6272047 |
T |
 |
| Q |
201 |
aatatcatggatttcaacccacatattgattagaacttctagaggaatctttttatcctcaggaaaggagca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6272046 |
aatatcatggatttcaacccacatattgattagaacttctagaggaatctttttatcctcaggaaaggagca |
6271975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 122 - 263
Target Start/End: Complemental strand, 6263443 - 6263302
Alignment:
| Q |
122 |
cataccgtgcctcttccactaaggtgaggagattcttgtttgaaagctcaaccacaattgcatatgcttctgtttcatgaatatcatggatttcaaccca |
221 |
Q |
| |
|
||||||| || |||| ||| |||||||| ||||| || || || |||||||| ||||| ||| | || ||| | |||| ||| ||||| ||||||||||| |
|
|
| T |
6263443 |
cataccgcgcttctttcaccaaggtgagaagatttttattggagagctcaacaacaatagcaaaagcatctttctcatcaatgtcatgaatttcaaccca |
6263344 |
T |
 |
| Q |
222 |
catattgattagaacttctagaggaatctttttatcctcagg |
263 |
Q |
| |
|
||||||||| ||| | |||||||| || ||||| |||||||| |
|
|
| T |
6263343 |
catattgatgagagcatctagagggatttttttgtcctcagg |
6263302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University