View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11493_low_24 (Length: 220)
Name: NF11493_low_24
Description: NF11493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11493_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 51673860 - 51673678
Alignment:
| Q |
17 |
cagagagtgtgtttgagtgcaagtgatggtggtgtggtttcgttggattggcctgttgaattggacttggaagaggaacgtggtttggattctacactac |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51673860 |
cagagagtttgtttgagtgcaagtgatggtggtgtggtttcgttggattggcctgttgaattggacttggaagaggaacgtggtttggattctacactac |
51673761 |
T |
 |
| Q |
117 |
tgattgtgcctggtactcctcaagggagtatggatgataatattagggtttttgtgattgatgctcttaagagaggctttttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51673760 |
tgattgtgcctggtactcctcaagggagtatggatgataatattagggtttttgtgattgatgctcttaagagagggtttttc |
51673678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University