View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11493_low_25 (Length: 202)
Name: NF11493_low_25
Description: NF11493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11493_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 8871764 - 8871591
Alignment:
| Q |
14 |
ttttttattagttctatttattattatttgataaataaatcaataatgagctgtatatatgggtgatacagattgaagaagattgtaagctaggcacagc |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8871764 |
ttttttattagtactatttattattatttgataaataaatcaataatgagctgtatatatgggtgatacagattgaagaagactgtaagctaggcacagc |
8871665 |
T |
 |
| Q |
114 |
aaatgacatagcagaagcagttcatcaaatattcagctacatcaataatggtagctaaagaagcaagtagctat |
187 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871664 |
aaatgatatagcagaagcagttcatcaaatattcagctacatcaataatggtagctaaagaagcaagtagctat |
8871591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University