View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11494_high_10 (Length: 426)
Name: NF11494_high_10
Description: NF11494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11494_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 14 - 423
Target Start/End: Original strand, 32967065 - 32967474
Alignment:
| Q |
14 |
tttgtgactatagtataattttaattgcaatatcttgaacatagtgcctaacttgcattgcatcttgtcgataaaaaatgtgagtagactatatggaagc |
113 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32967065 |
tttgtgactgtagtataattttaattgcaatatcttgaacatagtgcctaacttgcattgcatcttgtcgataaaaaatgtgagtagagtatatggaagc |
32967164 |
T |
|
| Q |
114 |
cacagcttttctgggtttcagcaggagctcctcttgcatgtgtcatcatttcaaccatcatcacttttgtaatcaagggtcaacttcatgatatcagtat |
213 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32967165 |
cacagcttttctgggtttcagctggagctcctcttgcatgtgtcatcatttcaaccatcatcacttttgtaatcaagggtcaacttcatgatatcagtat |
32967264 |
T |
|
| Q |
214 |
tgtaagtatctatagtgcttatgttatcatctatattattatgatttagtttcttaactaaaaaacaaatgtcatgttacttactagattggtaaattgc |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32967265 |
tgtaagtatctatagtgcttatgttatcatctatattattatgatttagtttcttaactaaaaaaaaaatgtcatgttacttactagattggtaaattgc |
32967364 |
T |
|
| Q |
314 |
aacaaggaataaatcctgcttcagtgaatatgttgctttttcacggaaagtatcttggtctcaccatcaaaaccgggattatcaccggcgttttatcact |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32967365 |
aacaaggaataaatcctgcttcagtgaatatgttgctttttcacggaaagtatcttggtctaaccatcaaaaccgggattatcaccggcgttttatcact |
32967464 |
T |
|
| Q |
414 |
caccgtaagt |
423 |
Q |
| |
|
|||||||||| |
|
|
| T |
32967465 |
caccgtaagt |
32967474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University