View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11494_high_15 (Length: 308)
Name: NF11494_high_15
Description: NF11494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11494_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 16 - 307
Target Start/End: Complemental strand, 23615438 - 23615151
Alignment:
| Q |
16 |
gagcagataggctcagatatatgaatatgaagttgaaattgaaacttgaaaattgaaattaagttgaaacgtctagagctatagctagggctctatattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23615438 |
gagcagataggctcagatatatgaatatgaagttgaaattgaaacttgaaaattgaaattaagttgaaacgtctagagctatagctagggctctatattt |
23615339 |
T |
 |
| Q |
116 |
ttctcagtcttgatggaggtgactgtgaactccaaggtttcatagtggacattacatggatcatcatagattgtttggcactgtgtgtttaatgttcaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23615338 |
ttctcagtcttgatggaggtgactgtgaactccaaggtttcatagtggacattacatggatcatcatagattgtttggcactgtgtgtttaatgttcaag |
23615239 |
T |
 |
| Q |
216 |
gatttattgtctgctagatagataagaggaccaaacattcatgttcattttgttaaatggtccaaattcatctacattcttcttctctctcg |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
23615238 |
tatttattgtctgcta----gataagaggaccaaacattcatattcattttgttaaatggtccaaattcatctacattctttttttctctcg |
23615151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University