View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11494_high_20 (Length: 291)
Name: NF11494_high_20
Description: NF11494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11494_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 3934403 - 3934140
Alignment:
| Q |
18 |
gttaaattagtcatatggttaagtaaatatcactttcattcttgtaaaataaataatataatcataactaatttt-gtttagccactcatccttatattg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3934403 |
gttaaattagtcatatggttaagtaaatatcactttcattcttgtaaaataaataatataatcataactaatttttgtttagccactcatccttatattg |
3934304 |
T |
 |
| Q |
117 |
tttaatatataaatcattgatggaatatcactattccag-tgtggtctttttcctatgtgagaggatcctttacttctctacaaaattgattaggcccga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3934303 |
tttaatatataaatcattgatggaatatcactattccaggtgtggtctttttcctatgtgagaggatcctttacttctctacaaaattgattaggcccga |
3934204 |
T |
 |
| Q |
216 |
tgcattattatcaggagatttgtttaaatattttaggtaattaaatcacctagattcatattcat |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3934203 |
tgcattattatcaggagatttgtttaaatattttaggtaattaaatcacct-gattcatattcat |
3934140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University