View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11494_low_20 (Length: 293)
Name: NF11494_low_20
Description: NF11494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11494_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 21 - 274
Target Start/End: Complemental strand, 45375518 - 45375265
Alignment:
| Q |
21 |
cacagagaaccgtcgcaggccacagcagctacttggcttgcactgttacttttaagtccaaagaagcctcatgtccccgtgcacggggttgaccatatag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45375518 |
cacagagaaccgtcgcaggccacagcagctacttggcttgcactgttacttttaagtccaaagaagcctcatgtccccgtgcacggggttgaccatatag |
45375419 |
T |
 |
| Q |
121 |
attgacacaagtagctagtttgccacatggaaaaatgaagggtcaacagataaagcaaagggcattttggtcttacacaataaattctctctgcgatccc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45375418 |
attgacacaagtagctagtttgccacatagaaaaatgaagggccaacagataaagcaaagggcattttggtcttacacaataaattctctctgcgatccc |
45375319 |
T |
 |
| Q |
221 |
agagttccagctttcttcacaaacccgtatgaaaatcatttgtggtagtgcctc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45375318 |
agagttccagctttcttcacaaacccgtatgaaaatcatttgtggtagtgcctc |
45375265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University