View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11494_low_28 (Length: 231)
Name: NF11494_low_28
Description: NF11494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11494_low_28 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 58 - 231
Target Start/End: Complemental strand, 7329009 - 7328836
Alignment:
| Q |
58 |
gtaatttatattcatacattccttttgtgtcttctcaattgaagtattggctttatggatgaaattgagcatgttcttgtggattttttaaactttacat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7329009 |
gtaatttatattcatacattccttttgtgtcttctcaattgaagtattggctttatggatgaaattgagcatgttcttgtggattttttaaactttacat |
7328910 |
T |
 |
| Q |
158 |
tttctcagatttttgagagttgagacttgttggtgatcaatttacaaagaccattgcttttagccttctaattt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
7328909 |
tttctcagatttttgagagttgagacttgttggtgattaattgacaaaaaccattgcttgtagccttctaattt |
7328836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University