View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11494_low_29 (Length: 223)
Name: NF11494_low_29
Description: NF11494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11494_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 12395451 - 12395639
Alignment:
| Q |
16 |
atgaaggattgctgattgaaactgcactttatggtgaaacttcgaatcacagttctcacaaatttccatctttgcctgatctgcaacatcattcagnnnn |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12395451 |
atgaagcattgctgattgaaactgcactttatggtgaaacttcgaatcacagttctcacaaatttccatctttgcctgatctgcaacatcattcagaaaa |
12395550 |
T |
 |
| Q |
116 |
nnntgctgatcccaaaaggcagcgttcatccagttcagcatctcaattattatctgagactcagttgataagacaacaacaggtttaga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12395551 |
aaatgctgatcccaaaaggcagcgttcatccagttcagcatctcaattattatctgagactcagttgataagacaacaacaggtttaga |
12395639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University