View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11496_high_15 (Length: 302)
Name: NF11496_high_15
Description: NF11496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11496_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 40586893 - 40586715
Alignment:
| Q |
16 |
atcaaatttagctagcatcaaaacttaaacctatnnnnnnnncaaaatgtttactctcataatattggaacaccatttgctagaaaagaaaatgaaggtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586893 |
atcaaatttagctagcatcaaaacttaaacctataaaaaaa-caaaatgtttactctcataatattggaacaccatttgctagaaaagaaaatgaaggtg |
40586795 |
T |
 |
| Q |
116 |
aaaaatagttgcgtttctttcacatagcatatatagcatctctttagtccatttctttttagtgtacatccactcatatc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586794 |
aaaaatagttgcgtttctttcacatagcatatatagcatctctttagtccatttctttttagtgtacatccactcatatc |
40586715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 242 - 286
Target Start/End: Complemental strand, 40586668 - 40586624
Alignment:
| Q |
242 |
agcaactactaacaaagttgttacttgccattgtacaagtaacat |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586668 |
agcaactactaacaaagttgttacttgccattgtacaagtaacat |
40586624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University