View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11497_high_4 (Length: 427)
Name: NF11497_high_4
Description: NF11497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11497_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 5e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 8 - 165
Target Start/End: Original strand, 41101145 - 41101302
Alignment:
| Q |
8 |
gcatgtggaaccaggagaaaggatctttgacatggctgatagcaaccattgagtccaagtagataatccctctttgcaccagcttcaaaccattgaagac |
107 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41101145 |
gcatatggaaccaggaggaaggatctttgacatggctgatagcacccattgagtccaagtagataatccctctttgcaccagcttcaaaccattgaagac |
41101244 |
T |
 |
| Q |
108 |
aaccagaagctcagcattgagattgttagaatggtcaatgtggcccaagaatcccaca |
165 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
41101245 |
aaccagaagctcagcattgagatttttagaatggtcaatgcggcccaagaatcccaca |
41101302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 341 - 411
Target Start/End: Original strand, 41101304 - 41101374
Alignment:
| Q |
341 |
aattgggtaattagagttgccccatcagtatgaagaaattcattcctaggatcatggtatggtaaatgact |
411 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41101304 |
aattgggtaattagagttaccccatcagtatgaagaaattcattcctaggatcatggtatggtaaatgact |
41101374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University